ID: 926698790

View in Genome Browser
Species Human (GRCh38)
Location 2:15788753-15788775
Sequence TCCCCCGTCTCCACACCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698790_926698794 3 Left 926698790 2:15788753-15788775 CCACTTGGTGTGGAGACGGGGGA No data
Right 926698794 2:15788779-15788801 GGCTCTGTCCCCTCGGGTGATGG No data
926698790_926698798 14 Left 926698790 2:15788753-15788775 CCACTTGGTGTGGAGACGGGGGA No data
Right 926698798 2:15788790-15788812 CTCGGGTGATGGCCCCTCAAAGG No data
926698790_926698799 15 Left 926698790 2:15788753-15788775 CCACTTGGTGTGGAGACGGGGGA No data
Right 926698799 2:15788791-15788813 TCGGGTGATGGCCCCTCAAAGGG No data
926698790_926698792 -4 Left 926698790 2:15788753-15788775 CCACTTGGTGTGGAGACGGGGGA No data
Right 926698792 2:15788772-15788794 GGGAAGTGGCTCTGTCCCCTCGG No data
926698790_926698793 -3 Left 926698790 2:15788753-15788775 CCACTTGGTGTGGAGACGGGGGA No data
Right 926698793 2:15788773-15788795 GGAAGTGGCTCTGTCCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698790 Original CRISPR TCCCCCGTCTCCACACCAAG TGG (reversed) Intergenic