ID: 926698791

View in Genome Browser
Species Human (GRCh38)
Location 2:15788758-15788780
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698776_926698791 21 Left 926698776 2:15788714-15788736 CCCCCGGATGCCTCACTCTGGTG No data
Right 926698791 2:15788758-15788780 TGGTGTGGAGACGGGGGAAGTGG No data
926698782_926698791 11 Left 926698782 2:15788724-15788746 CCTCACTCTGGTGGCTGGCTCTA No data
Right 926698791 2:15788758-15788780 TGGTGTGGAGACGGGGGAAGTGG No data
926698780_926698791 18 Left 926698780 2:15788717-15788739 CCGGATGCCTCACTCTGGTGGCT No data
Right 926698791 2:15788758-15788780 TGGTGTGGAGACGGGGGAAGTGG No data
926698774_926698791 27 Left 926698774 2:15788708-15788730 CCTCTGCCCCCGGATGCCTCACT No data
Right 926698791 2:15788758-15788780 TGGTGTGGAGACGGGGGAAGTGG No data
926698779_926698791 19 Left 926698779 2:15788716-15788738 CCCGGATGCCTCACTCTGGTGGC No data
Right 926698791 2:15788758-15788780 TGGTGTGGAGACGGGGGAAGTGG No data
926698777_926698791 20 Left 926698777 2:15788715-15788737 CCCCGGATGCCTCACTCTGGTGG No data
Right 926698791 2:15788758-15788780 TGGTGTGGAGACGGGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type