ID: 926698792

View in Genome Browser
Species Human (GRCh38)
Location 2:15788772-15788794
Sequence GGGAAGTGGCTCTGTCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926698782_926698792 25 Left 926698782 2:15788724-15788746 CCTCACTCTGGTGGCTGGCTCTA No data
Right 926698792 2:15788772-15788794 GGGAAGTGGCTCTGTCCCCTCGG No data
926698790_926698792 -4 Left 926698790 2:15788753-15788775 CCACTTGGTGTGGAGACGGGGGA No data
Right 926698792 2:15788772-15788794 GGGAAGTGGCTCTGTCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926698792 Original CRISPR GGGAAGTGGCTCTGTCCCCT CGG Intergenic
No off target data available for this crispr