ID: 926699158

View in Genome Browser
Species Human (GRCh38)
Location 2:15791070-15791092
Sequence AATAATGCATCTACAGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926699158_926699165 22 Left 926699158 2:15791070-15791092 CCCATAGCTGTAGATGCATTATT No data
Right 926699165 2:15791115-15791137 AAAGAGGAGTGAGGCAAGCACGG No data
926699158_926699162 6 Left 926699158 2:15791070-15791092 CCCATAGCTGTAGATGCATTATT No data
Right 926699162 2:15791099-15791121 CCTTCACATTCTCCAGAAAGAGG No data
926699158_926699166 27 Left 926699158 2:15791070-15791092 CCCATAGCTGTAGATGCATTATT No data
Right 926699166 2:15791120-15791142 GGAGTGAGGCAAGCACGGAAAGG No data
926699158_926699163 13 Left 926699158 2:15791070-15791092 CCCATAGCTGTAGATGCATTATT No data
Right 926699163 2:15791106-15791128 ATTCTCCAGAAAGAGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926699158 Original CRISPR AATAATGCATCTACAGCTAT GGG (reversed) Intergenic
No off target data available for this crispr