ID: 926700177

View in Genome Browser
Species Human (GRCh38)
Location 2:15798242-15798264
Sequence TTCCCGTGGGCAGGTGGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926700177_926700183 -8 Left 926700177 2:15798242-15798264 CCGTCACCACCTGCCCACGGGAA No data
Right 926700183 2:15798257-15798279 CACGGGAATGCAGCCATCTAGGG No data
926700177_926700187 2 Left 926700177 2:15798242-15798264 CCGTCACCACCTGCCCACGGGAA No data
Right 926700187 2:15798267-15798289 CAGCCATCTAGGGAATGTGGGGG No data
926700177_926700184 -1 Left 926700177 2:15798242-15798264 CCGTCACCACCTGCCCACGGGAA No data
Right 926700184 2:15798264-15798286 ATGCAGCCATCTAGGGAATGTGG No data
926700177_926700185 0 Left 926700177 2:15798242-15798264 CCGTCACCACCTGCCCACGGGAA No data
Right 926700185 2:15798265-15798287 TGCAGCCATCTAGGGAATGTGGG No data
926700177_926700189 23 Left 926700177 2:15798242-15798264 CCGTCACCACCTGCCCACGGGAA No data
Right 926700189 2:15798288-15798310 GGTCCTCAGAGTTGCCCCTGAGG No data
926700177_926700186 1 Left 926700177 2:15798242-15798264 CCGTCACCACCTGCCCACGGGAA No data
Right 926700186 2:15798266-15798288 GCAGCCATCTAGGGAATGTGGGG No data
926700177_926700192 30 Left 926700177 2:15798242-15798264 CCGTCACCACCTGCCCACGGGAA No data
Right 926700192 2:15798295-15798317 AGAGTTGCCCCTGAGGGCCAAGG No data
926700177_926700190 24 Left 926700177 2:15798242-15798264 CCGTCACCACCTGCCCACGGGAA No data
Right 926700190 2:15798289-15798311 GTCCTCAGAGTTGCCCCTGAGGG No data
926700177_926700182 -9 Left 926700177 2:15798242-15798264 CCGTCACCACCTGCCCACGGGAA No data
Right 926700182 2:15798256-15798278 CCACGGGAATGCAGCCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926700177 Original CRISPR TTCCCGTGGGCAGGTGGTGA CGG (reversed) Intergenic
No off target data available for this crispr