ID: 926701496

View in Genome Browser
Species Human (GRCh38)
Location 2:15807182-15807204
Sequence GCCGCAGGCTGGTACCGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926701485_926701496 20 Left 926701485 2:15807139-15807161 CCTGTGCTCTAGGTTGTCTAGAG No data
Right 926701496 2:15807182-15807204 GCCGCAGGCTGGTACCGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926701496 Original CRISPR GCCGCAGGCTGGTACCGATT TGG Intergenic