ID: 926702646

View in Genome Browser
Species Human (GRCh38)
Location 2:15813961-15813983
Sequence GTGCATGAGGAGCAAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926702646_926702652 1 Left 926702646 2:15813961-15813983 CCCACCCTTTGCTCCTCATGCAC No data
Right 926702652 2:15813985-15814007 AGCTCTGCTGACCTCACAGCAGG No data
926702646_926702655 21 Left 926702646 2:15813961-15813983 CCCACCCTTTGCTCCTCATGCAC No data
Right 926702655 2:15814005-15814027 AGGTCTCCATACTGGCCCTGCGG No data
926702646_926702654 13 Left 926702646 2:15813961-15813983 CCCACCCTTTGCTCCTCATGCAC No data
Right 926702654 2:15813997-15814019 CTCACAGCAGGTCTCCATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926702646 Original CRISPR GTGCATGAGGAGCAAAGGGT GGG (reversed) Intergenic
No off target data available for this crispr