ID: 926702837

View in Genome Browser
Species Human (GRCh38)
Location 2:15815308-15815330
Sequence CTGAGGAAACAGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926702837_926702844 18 Left 926702837 2:15815308-15815330 CCTCCTTCCTTCTGTTTCCTCAG No data
Right 926702844 2:15815349-15815371 AAACTGAGGGTCTACTAGGTAGG No data
926702837_926702843 14 Left 926702837 2:15815308-15815330 CCTCCTTCCTTCTGTTTCCTCAG No data
Right 926702843 2:15815345-15815367 AGACAAACTGAGGGTCTACTAGG No data
926702837_926702842 5 Left 926702837 2:15815308-15815330 CCTCCTTCCTTCTGTTTCCTCAG No data
Right 926702842 2:15815336-15815358 CAATGACAAAGACAAACTGAGGG No data
926702837_926702841 4 Left 926702837 2:15815308-15815330 CCTCCTTCCTTCTGTTTCCTCAG No data
Right 926702841 2:15815335-15815357 ACAATGACAAAGACAAACTGAGG No data
926702837_926702845 24 Left 926702837 2:15815308-15815330 CCTCCTTCCTTCTGTTTCCTCAG No data
Right 926702845 2:15815355-15815377 AGGGTCTACTAGGTAGGACGAGG No data
926702837_926702846 25 Left 926702837 2:15815308-15815330 CCTCCTTCCTTCTGTTTCCTCAG No data
Right 926702846 2:15815356-15815378 GGGTCTACTAGGTAGGACGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926702837 Original CRISPR CTGAGGAAACAGAAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr