ID: 926704811

View in Genome Browser
Species Human (GRCh38)
Location 2:15829452-15829474
Sequence GGTCTGAGAGCAGGACAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926704801_926704811 12 Left 926704801 2:15829417-15829439 CCCAGAGTCCAAAGGCCCCAAAC No data
Right 926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG No data
926704804_926704811 4 Left 926704804 2:15829425-15829447 CCAAAGGCCCCAAACAAGGAAAT No data
Right 926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG No data
926704808_926704811 -5 Left 926704808 2:15829434-15829456 CCAAACAAGGAAATCCAAGGTCT No data
Right 926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG No data
926704807_926704811 -4 Left 926704807 2:15829433-15829455 CCCAAACAAGGAAATCCAAGGTC No data
Right 926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG No data
926704802_926704811 11 Left 926704802 2:15829418-15829440 CCAGAGTCCAAAGGCCCCAAACA No data
Right 926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG No data
926704806_926704811 -3 Left 926704806 2:15829432-15829454 CCCCAAACAAGGAAATCCAAGGT No data
Right 926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926704811 Original CRISPR GGTCTGAGAGCAGGACAAGA TGG Intergenic
No off target data available for this crispr