ID: 926704835

View in Genome Browser
Species Human (GRCh38)
Location 2:15829651-15829673
Sequence TATAGGCATGAGCCACCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926704835_926704842 27 Left 926704835 2:15829651-15829673 CCTGGTGGTGGCTCATGCCTATA No data
Right 926704842 2:15829701-15829723 TGAAGCGTGTAGATCACCTGAGG No data
926704835_926704841 3 Left 926704835 2:15829651-15829673 CCTGGTGGTGGCTCATGCCTATA No data
Right 926704841 2:15829677-15829699 CCAGCACTCAGTACTTTGGGAGG No data
926704835_926704837 -1 Left 926704835 2:15829651-15829673 CCTGGTGGTGGCTCATGCCTATA No data
Right 926704837 2:15829673-15829695 AATCCCAGCACTCAGTACTTTGG No data
926704835_926704838 0 Left 926704835 2:15829651-15829673 CCTGGTGGTGGCTCATGCCTATA No data
Right 926704838 2:15829674-15829696 ATCCCAGCACTCAGTACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926704835 Original CRISPR TATAGGCATGAGCCACCACC AGG (reversed) Intergenic
No off target data available for this crispr