ID: 926706220

View in Genome Browser
Species Human (GRCh38)
Location 2:15839619-15839641
Sequence GCATCTAGTATTTGGAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706220_926706223 6 Left 926706220 2:15839619-15839641 CCTGATCTCCAAATACTAGATGC No data
Right 926706223 2:15839648-15839670 AATGACCTTCAGCTGGCGACAGG No data
926706220_926706222 -1 Left 926706220 2:15839619-15839641 CCTGATCTCCAAATACTAGATGC No data
Right 926706222 2:15839641-15839663 CAACTTAAATGACCTTCAGCTGG No data
926706220_926706225 18 Left 926706220 2:15839619-15839641 CCTGATCTCCAAATACTAGATGC No data
Right 926706225 2:15839660-15839682 CTGGCGACAGGATAAACAAATGG No data
926706220_926706226 25 Left 926706220 2:15839619-15839641 CCTGATCTCCAAATACTAGATGC No data
Right 926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706220 Original CRISPR GCATCTAGTATTTGGAGATC AGG (reversed) Intergenic
No off target data available for this crispr