ID: 926706221

View in Genome Browser
Species Human (GRCh38)
Location 2:15839627-15839649
Sequence TTTAAGTTGCATCTAGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706221_926706223 -2 Left 926706221 2:15839627-15839649 CCAAATACTAGATGCAACTTAAA No data
Right 926706223 2:15839648-15839670 AATGACCTTCAGCTGGCGACAGG No data
926706221_926706226 17 Left 926706221 2:15839627-15839649 CCAAATACTAGATGCAACTTAAA No data
Right 926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG No data
926706221_926706225 10 Left 926706221 2:15839627-15839649 CCAAATACTAGATGCAACTTAAA No data
Right 926706225 2:15839660-15839682 CTGGCGACAGGATAAACAAATGG No data
926706221_926706222 -9 Left 926706221 2:15839627-15839649 CCAAATACTAGATGCAACTTAAA No data
Right 926706222 2:15839641-15839663 CAACTTAAATGACCTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706221 Original CRISPR TTTAAGTTGCATCTAGTATT TGG (reversed) Intergenic
No off target data available for this crispr