ID: 926706224

View in Genome Browser
Species Human (GRCh38)
Location 2:15839653-15839675
Sequence TTTATCCTGTCGCCAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706224_926706227 7 Left 926706224 2:15839653-15839675 CCTTCAGCTGGCGACAGGATAAA No data
Right 926706227 2:15839683-15839705 TGCATGGTGCACCCATGCAATGG No data
926706224_926706230 22 Left 926706224 2:15839653-15839675 CCTTCAGCTGGCGACAGGATAAA No data
Right 926706230 2:15839698-15839720 TGCAATGGAATATATTCCCTAGG No data
926706224_926706226 -9 Left 926706224 2:15839653-15839675 CCTTCAGCTGGCGACAGGATAAA No data
Right 926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706224 Original CRISPR TTTATCCTGTCGCCAGCTGA AGG (reversed) Intergenic
No off target data available for this crispr