ID: 926706226

View in Genome Browser
Species Human (GRCh38)
Location 2:15839667-15839689
Sequence CAGGATAAACAAATGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706221_926706226 17 Left 926706221 2:15839627-15839649 CCAAATACTAGATGCAACTTAAA No data
Right 926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG No data
926706224_926706226 -9 Left 926706224 2:15839653-15839675 CCTTCAGCTGGCGACAGGATAAA No data
Right 926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG No data
926706220_926706226 25 Left 926706220 2:15839619-15839641 CCTGATCTCCAAATACTAGATGC No data
Right 926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706226 Original CRISPR CAGGATAAACAAATGGTGCA TGG Intergenic
No off target data available for this crispr