ID: 926706288

View in Genome Browser
Species Human (GRCh38)
Location 2:15840099-15840121
Sequence ATCTGAGAAGGACTCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706288_926706292 4 Left 926706288 2:15840099-15840121 CCAGGGCAGAGTCCTTCTCAGAT No data
Right 926706292 2:15840126-15840148 TCCCGGGCCCAGCACCCTGCAGG No data
926706288_926706300 19 Left 926706288 2:15840099-15840121 CCAGGGCAGAGTCCTTCTCAGAT No data
Right 926706300 2:15840141-15840163 CCTGCAGGCACCTGGTGCTCAGG No data
926706288_926706301 20 Left 926706288 2:15840099-15840121 CCAGGGCAGAGTCCTTCTCAGAT No data
Right 926706301 2:15840142-15840164 CTGCAGGCACCTGGTGCTCAGGG No data
926706288_926706296 11 Left 926706288 2:15840099-15840121 CCAGGGCAGAGTCCTTCTCAGAT No data
Right 926706296 2:15840133-15840155 CCCAGCACCCTGCAGGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706288 Original CRISPR ATCTGAGAAGGACTCTGCCC TGG (reversed) Intergenic