ID: 926706291

View in Genome Browser
Species Human (GRCh38)
Location 2:15840111-15840133
Sequence GCCCGGGAAGAGATCTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706291_926706296 -1 Left 926706291 2:15840111-15840133 CCTTCTCAGATCTCTTCCCGGGC No data
Right 926706296 2:15840133-15840155 CCCAGCACCCTGCAGGCACCTGG No data
926706291_926706300 7 Left 926706291 2:15840111-15840133 CCTTCTCAGATCTCTTCCCGGGC No data
Right 926706300 2:15840141-15840163 CCTGCAGGCACCTGGTGCTCAGG No data
926706291_926706301 8 Left 926706291 2:15840111-15840133 CCTTCTCAGATCTCTTCCCGGGC No data
Right 926706301 2:15840142-15840164 CTGCAGGCACCTGGTGCTCAGGG No data
926706291_926706292 -8 Left 926706291 2:15840111-15840133 CCTTCTCAGATCTCTTCCCGGGC No data
Right 926706292 2:15840126-15840148 TCCCGGGCCCAGCACCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706291 Original CRISPR GCCCGGGAAGAGATCTGAGA AGG (reversed) Intergenic