ID: 926706292

View in Genome Browser
Species Human (GRCh38)
Location 2:15840126-15840148
Sequence TCCCGGGCCCAGCACCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706291_926706292 -8 Left 926706291 2:15840111-15840133 CCTTCTCAGATCTCTTCCCGGGC No data
Right 926706292 2:15840126-15840148 TCCCGGGCCCAGCACCCTGCAGG No data
926706285_926706292 29 Left 926706285 2:15840074-15840096 CCTCACACACTAGGCTAGAGACT No data
Right 926706292 2:15840126-15840148 TCCCGGGCCCAGCACCCTGCAGG No data
926706288_926706292 4 Left 926706288 2:15840099-15840121 CCAGGGCAGAGTCCTTCTCAGAT No data
Right 926706292 2:15840126-15840148 TCCCGGGCCCAGCACCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706292 Original CRISPR TCCCGGGCCCAGCACCCTGC AGG Intergenic