ID: 926706293

View in Genome Browser
Species Human (GRCh38)
Location 2:15840127-15840149
Sequence GCCTGCAGGGTGCTGGGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706293_926706300 -9 Left 926706293 2:15840127-15840149 CCCGGGCCCAGCACCCTGCAGGC No data
Right 926706300 2:15840141-15840163 CCTGCAGGCACCTGGTGCTCAGG 0: 1
1: 0
2: 4
3: 36
4: 307
926706293_926706301 -8 Left 926706293 2:15840127-15840149 CCCGGGCCCAGCACCCTGCAGGC No data
Right 926706301 2:15840142-15840164 CTGCAGGCACCTGGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706293 Original CRISPR GCCTGCAGGGTGCTGGGCCC GGG (reversed) Intergenic