ID: 926706294

View in Genome Browser
Species Human (GRCh38)
Location 2:15840128-15840150
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706294_926706300 -10 Left 926706294 2:15840128-15840150 CCGGGCCCAGCACCCTGCAGGCA No data
Right 926706300 2:15840141-15840163 CCTGCAGGCACCTGGTGCTCAGG 0: 1
1: 0
2: 4
3: 36
4: 307
926706294_926706301 -9 Left 926706294 2:15840128-15840150 CCGGGCCCAGCACCCTGCAGGCA No data
Right 926706301 2:15840142-15840164 CTGCAGGCACCTGGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706294 Original CRISPR TGCCTGCAGGGTGCTGGGCC CGG (reversed) Intergenic