ID: 926706296

View in Genome Browser
Species Human (GRCh38)
Location 2:15840133-15840155
Sequence CCCAGCACCCTGCAGGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 1, 2: 6, 3: 86, 4: 579}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706291_926706296 -1 Left 926706291 2:15840111-15840133 CCTTCTCAGATCTCTTCCCGGGC No data
Right 926706296 2:15840133-15840155 CCCAGCACCCTGCAGGCACCTGG 0: 1
1: 1
2: 6
3: 86
4: 579
926706288_926706296 11 Left 926706288 2:15840099-15840121 CCAGGGCAGAGTCCTTCTCAGAT No data
Right 926706296 2:15840133-15840155 CCCAGCACCCTGCAGGCACCTGG 0: 1
1: 1
2: 6
3: 86
4: 579

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706296 Original CRISPR CCCAGCACCCTGCAGGCACC TGG Intergenic