ID: 926706300

View in Genome Browser
Species Human (GRCh38)
Location 2:15840141-15840163
Sequence CCTGCAGGCACCTGGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926706294_926706300 -10 Left 926706294 2:15840128-15840150 CCGGGCCCAGCACCCTGCAGGCA No data
Right 926706300 2:15840141-15840163 CCTGCAGGCACCTGGTGCTCAGG No data
926706288_926706300 19 Left 926706288 2:15840099-15840121 CCAGGGCAGAGTCCTTCTCAGAT No data
Right 926706300 2:15840141-15840163 CCTGCAGGCACCTGGTGCTCAGG No data
926706291_926706300 7 Left 926706291 2:15840111-15840133 CCTTCTCAGATCTCTTCCCGGGC No data
Right 926706300 2:15840141-15840163 CCTGCAGGCACCTGGTGCTCAGG No data
926706293_926706300 -9 Left 926706293 2:15840127-15840149 CCCGGGCCCAGCACCCTGCAGGC No data
Right 926706300 2:15840141-15840163 CCTGCAGGCACCTGGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926706300 Original CRISPR CCTGCAGGCACCTGGTGCTC AGG Intergenic