ID: 926707365

View in Genome Browser
Species Human (GRCh38)
Location 2:15846222-15846244
Sequence GCTCAGAGCTGGCCTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926707357_926707365 8 Left 926707357 2:15846191-15846213 CCCCAGTGAGTTCCCTGAATATT No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707351_926707365 29 Left 926707351 2:15846170-15846192 CCCAGCCCCATGCTCCTCACTCC No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707354_926707365 23 Left 926707354 2:15846176-15846198 CCCATGCTCCTCACTCCCCAGTG No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707355_926707365 22 Left 926707355 2:15846177-15846199 CCATGCTCCTCACTCCCCAGTGA No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707356_926707365 15 Left 926707356 2:15846184-15846206 CCTCACTCCCCAGTGAGTTCCCT No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707358_926707365 7 Left 926707358 2:15846192-15846214 CCCAGTGAGTTCCCTGAATATTC No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707362_926707365 -5 Left 926707362 2:15846204-15846226 CCTGAATATTCATCTCTGGCTCA No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707359_926707365 6 Left 926707359 2:15846193-15846215 CCAGTGAGTTCCCTGAATATTCA No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707353_926707365 24 Left 926707353 2:15846175-15846197 CCCCATGCTCCTCACTCCCCAGT No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707361_926707365 -4 Left 926707361 2:15846203-15846225 CCCTGAATATTCATCTCTGGCTC No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data
926707352_926707365 28 Left 926707352 2:15846171-15846193 CCAGCCCCATGCTCCTCACTCCC No data
Right 926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926707365 Original CRISPR GCTCAGAGCTGGCCTCCAGG AGG Intergenic
No off target data available for this crispr