ID: 926708840

View in Genome Browser
Species Human (GRCh38)
Location 2:15859033-15859055
Sequence CTGTGCTTTTAGAGGTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926708840_926708842 2 Left 926708840 2:15859033-15859055 CCAGGTGACCTCTAAAAGCACAG No data
Right 926708842 2:15859058-15859080 ACCTCACTATTTCCTCTGCCTGG No data
926708840_926708845 13 Left 926708840 2:15859033-15859055 CCAGGTGACCTCTAAAAGCACAG No data
Right 926708845 2:15859069-15859091 TCCTCTGCCTGGAATGTCTTGGG No data
926708840_926708844 12 Left 926708840 2:15859033-15859055 CCAGGTGACCTCTAAAAGCACAG No data
Right 926708844 2:15859068-15859090 TTCCTCTGCCTGGAATGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926708840 Original CRISPR CTGTGCTTTTAGAGGTCACC TGG (reversed) Intergenic
No off target data available for this crispr