ID: 926710135

View in Genome Browser
Species Human (GRCh38)
Location 2:15872699-15872721
Sequence CCAGCCCGCCTCCACCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926710135_926710139 -5 Left 926710135 2:15872699-15872721 CCATCCTGGTGGAGGCGGGCTGG No data
Right 926710139 2:15872717-15872739 GCTGGTGGAACTCTCCCTATCGG No data
926710135_926710144 24 Left 926710135 2:15872699-15872721 CCATCCTGGTGGAGGCGGGCTGG No data
Right 926710144 2:15872746-15872768 TGCCAACTCCCCACATGGTGTGG No data
926710135_926710143 19 Left 926710135 2:15872699-15872721 CCATCCTGGTGGAGGCGGGCTGG No data
Right 926710143 2:15872741-15872763 CACAGTGCCAACTCCCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926710135 Original CRISPR CCAGCCCGCCTCCACCAGGA TGG (reversed) Intergenic
No off target data available for this crispr