ID: 926712648

View in Genome Browser
Species Human (GRCh38)
Location 2:15894290-15894312
Sequence GCTGAGGTGCAGACTGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926712648_926712665 26 Left 926712648 2:15894290-15894312 CCCTCCCCAGTCTGCACCTCAGC No data
Right 926712665 2:15894339-15894361 CATTGGTGGTCGGCTTCCAAGGG No data
926712648_926712657 0 Left 926712648 2:15894290-15894312 CCCTCCCCAGTCTGCACCTCAGC No data
Right 926712657 2:15894313-15894335 TTCCCCATCGGGCAATGAGGTGG No data
926712648_926712656 -3 Left 926712648 2:15894290-15894312 CCCTCCCCAGTCTGCACCTCAGC No data
Right 926712656 2:15894310-15894332 AGCTTCCCCATCGGGCAATGAGG No data
926712648_926712663 16 Left 926712648 2:15894290-15894312 CCCTCCCCAGTCTGCACCTCAGC No data
Right 926712663 2:15894329-15894351 GAGGTGGCTGCATTGGTGGTCGG No data
926712648_926712661 9 Left 926712648 2:15894290-15894312 CCCTCCCCAGTCTGCACCTCAGC No data
Right 926712661 2:15894322-15894344 GGGCAATGAGGTGGCTGCATTGG No data
926712648_926712664 25 Left 926712648 2:15894290-15894312 CCCTCCCCAGTCTGCACCTCAGC No data
Right 926712664 2:15894338-15894360 GCATTGGTGGTCGGCTTCCAAGG No data
926712648_926712662 12 Left 926712648 2:15894290-15894312 CCCTCCCCAGTCTGCACCTCAGC No data
Right 926712662 2:15894325-15894347 CAATGAGGTGGCTGCATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926712648 Original CRISPR GCTGAGGTGCAGACTGGGGA GGG (reversed) Intergenic
No off target data available for this crispr