ID: 926718621

View in Genome Browser
Species Human (GRCh38)
Location 2:15942697-15942719
Sequence TGCCCCGGCGGCGGGCCCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 270}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926718605_926718621 24 Left 926718605 2:15942650-15942672 CCCGTGAACAAGCGCGAGCCAGC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 270
926718612_926718621 -7 Left 926718612 2:15942681-15942703 CCGCAGCCCCGGCCAGTGCCCCG 0: 1
1: 0
2: 8
3: 84
4: 809
Right 926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 270
926718604_926718621 29 Left 926718604 2:15942645-15942667 CCTTTCCCGTGAACAAGCGCGAG 0: 1
1: 0
2: 0
3: 2
4: 19
Right 926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 270
926718606_926718621 23 Left 926718606 2:15942651-15942673 CCGTGAACAAGCGCGAGCCAGCG 0: 1
1: 0
2: 0
3: 3
4: 29
Right 926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 270
926718610_926718621 -1 Left 926718610 2:15942675-15942697 CCGTGCCCGCAGCCCCGGCCAGT 0: 1
1: 0
2: 2
3: 23
4: 351
Right 926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 270
926718603_926718621 30 Left 926718603 2:15942644-15942666 CCCTTTCCCGTGAACAAGCGCGA 0: 1
1: 0
2: 0
3: 1
4: 18
Right 926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 270
926718607_926718621 6 Left 926718607 2:15942668-15942690 CCAGCGCCCGTGCCCGCAGCCCC 0: 1
1: 0
2: 5
3: 96
4: 673
Right 926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 270
926718609_926718621 0 Left 926718609 2:15942674-15942696 CCCGTGCCCGCAGCCCCGGCCAG 0: 1
1: 0
2: 5
3: 52
4: 525
Right 926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 270
926718611_926718621 -6 Left 926718611 2:15942680-15942702 CCCGCAGCCCCGGCCAGTGCCCC 0: 1
1: 1
2: 6
3: 83
4: 739
Right 926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG 0: 1
1: 0
2: 1
3: 15
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926718621 Original CRISPR TGCCCCGGCGGCGGGCCCTG CGG Exonic
900269144 1:1778338-1778360 CGGCGCGGCGGCGGGGCCTGCGG - Intronic
900360079 1:2284161-2284183 GGCCCCAGAGGCCGGCCCTGGGG + Intronic
900439023 1:2644182-2644204 TGCCCCAGTGGTGGGCCCGGGGG + Intronic
900478509 1:2887296-2887318 TTCCCCTGTGGCTGGCCCTGCGG + Intergenic
901088250 1:6625163-6625185 GGCGGCGGCGGCGGGGCCTGCGG - Exonic
902304114 1:15524286-15524308 TGACGCGGGGGCAGGCCCTGGGG - Exonic
905803733 1:40861778-40861800 GGCGCCGGCTGCGGGCCCGGGGG + Exonic
909001413 1:70221676-70221698 GGCCCCAGCGGCGGGCCCGGTGG + Exonic
910232156 1:84997673-84997695 GACCCGGGCGGTGGGCCCTGCGG + Intergenic
910676543 1:89821544-89821566 GCCCCGGGCGGCCGGCCCTGCGG + Intronic
911664767 1:100539781-100539803 TGCACCCGCGGCGGGCACAGCGG + Exonic
912955564 1:114152653-114152675 CGCCCTGGCGGCGGGAGCTGCGG - Exonic
915312677 1:155012203-155012225 TGCCACGGAGACCGGCCCTGGGG + Intronic
916721305 1:167486519-167486541 TGGACCGGCGGCTGGGCCTGAGG - Intronic
917817510 1:178725532-178725554 TCTCCCGGCCGCGGGCCCCGGGG + Intronic
919724530 1:200873228-200873250 TGGCCGGGCGGCGGGGCCCGCGG + Exonic
1065588249 10:27240891-27240913 TGCCGCGGCGGCGGGTCGGGTGG - Intronic
1067346210 10:45440816-45440838 TGCCCCAGCCGCGTGTCCTGGGG - Intronic
1069891524 10:71655442-71655464 TGCCAAGGAGGCTGGCCCTGAGG - Intronic
1070032664 10:72692362-72692384 TGCCCCGGCGGCCTGCCCGCCGG - Intronic
1073363506 10:102918576-102918598 TCCCCCGGCCGCGAGCGCTGAGG - Exonic
1076724310 10:132406354-132406376 TGCCTCTGCTCCGGGCCCTGAGG + Intronic
1076880310 10:133236564-133236586 AGCCCGGGAGGCGGGCGCTGGGG - Intergenic
1076948313 10:133666005-133666027 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076949302 10:133669315-133669337 TGCCCCGCCGGCCGGCGCGGCGG - Intronic
1076950286 10:133672614-133672636 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076951271 10:133675913-133675935 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076952261 10:133679223-133679245 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076953249 10:133682533-133682555 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076955217 10:133742184-133742206 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076956207 10:133745494-133745516 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076957195 10:133748803-133748825 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076958184 10:133752113-133752135 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076959168 10:133755412-133755434 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1076960157 10:133758722-133758744 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
1078830753 11:14974258-14974280 CGCCCTGCCGGCGGACCCTGCGG - Intronic
1082824520 11:57567924-57567946 TGCACCGGCGGCGAGCGCTCAGG + Intronic
1083431015 11:62613476-62613498 TGCCCTGGCAGCGGGCGCGGTGG + Exonic
1083673942 11:64315196-64315218 TGCGGCGGCTGCAGGCCCTGCGG + Exonic
1083708430 11:64532328-64532350 AGCCCCGATGTCGGGCCCTGGGG - Intergenic
1083940121 11:65891228-65891250 GGCCCCCGCGGCGGCCCCAGCGG + Exonic
1084009276 11:66338664-66338686 TGCCAGGGTGGGGGGCCCTGAGG + Intronic
1084621058 11:70270627-70270649 CGCCCCGGGGGCGGGGCCCGAGG - Intergenic
1084841549 11:71855515-71855537 AGCCACTGCGGCCGGCCCTGAGG - Intergenic
1085474854 11:76783340-76783362 CGGCCCGGCCGCGGGCCCTCCGG - Intronic
1089603667 11:119629347-119629369 TCCCCCGACGCCTGGCCCTGGGG - Intronic
1091121954 11:133064518-133064540 TGGCCCTGCAGCGGCCCCTGAGG - Intronic
1091616381 12:2053688-2053710 GGCCCCGGGGCCGGTCCCTGCGG + Intronic
1092131223 12:6114580-6114602 TGGCCAGGCGGCAGACCCTGGGG + Intronic
1092163238 12:6327638-6327660 GGCCCCGAAGCCGGGCCCTGTGG - Exonic
1094831937 12:34304291-34304313 AGCCCCTGCGGTGGGCCCTGGGG + Intergenic
1095097327 12:38155614-38155636 AGCCCCTGCGCCGGGCCCGGGGG + Intergenic
1095097453 12:38156036-38156058 AGCCCCTGCGCCGGGCACTGGGG + Intergenic
1095206053 12:39442414-39442436 TGGGCGCGCGGCGGGCCCTGCGG + Intronic
1095450512 12:42326103-42326125 GGCCCCGAAGGCGGGCCCAGAGG + Exonic
1096105886 12:48997046-48997068 GGCCCCGGCGTAGGGCCCTGGGG + Exonic
1096134594 12:49188808-49188830 TGCGGCGGCGGCGGGGCTTGAGG + Intronic
1096204072 12:49706994-49707016 AGCCCGGGCGTCGGGACCTGAGG + Intronic
1101168338 12:102062052-102062074 GGCCCCGGAGGCGGGCACTTGGG - Exonic
1101444881 12:104730587-104730609 TGGCCCAGCGACGGGCCCAGAGG + Intronic
1103557133 12:121773463-121773485 TCTACCGGCTGCGGGCCCTGGGG + Exonic
1103764470 12:123271105-123271127 AGCCCGGGCGGGGGGCGCTGCGG - Intronic
1104639881 12:130460765-130460787 GTCCCCGGCGCCAGGCCCTGGGG - Intronic
1104719992 12:131039921-131039943 GGCCCTGCCGGCGGTCCCTGAGG + Intronic
1104857120 12:131907571-131907593 GGCCCTGGGTGCGGGCCCTGTGG - Intronic
1105277478 13:18944280-18944302 TGCCCCTGCGCCGGGCCCGGGGG - Intergenic
1105454141 13:20525466-20525488 CGCCCAGGCCGCGGGGCCTGCGG - Intronic
1107467807 13:40665824-40665846 GGCCCGGGCGGCGGGGGCTGCGG + Exonic
1110436422 13:75481960-75481982 GGCTCCGGCGGCGGGCACCGAGG + Exonic
1110705941 13:78602181-78602203 GGCCCGGGCGGCGGCCCCGGGGG - Exonic
1113201001 13:107867345-107867367 AGCCCCGGCGGCGGCGCCCGCGG - Intergenic
1113404367 13:110024242-110024264 TGCCCCTGCAGAAGGCCCTGGGG + Intergenic
1113653353 13:112053676-112053698 GGCACCGGAGGCGGCCCCTGGGG - Intergenic
1115320744 14:32077124-32077146 CGGCGCGGCGGCGGGCGCTGGGG + Intronic
1117298043 14:54396811-54396833 CGCGCGGGAGGCGGGCCCTGTGG - Intergenic
1117546668 14:56798643-56798665 TGCCCCAGCTGGGGGCCCTCGGG + Intergenic
1117675601 14:58152136-58152158 CATCCCAGCGGCGGGCCCTGCGG + Exonic
1121837129 14:97102237-97102259 TGCCCCAGCGGAGAGCCATGTGG + Intergenic
1122779640 14:104138345-104138367 TGCCCCGGGGAGGGGCGCTGGGG - Intergenic
1122887048 14:104714783-104714805 AGGCCCGGCCCCGGGCCCTGGGG - Exonic
1122901949 14:104785673-104785695 TGCCTTGGCGGCAGGACCTGGGG - Intronic
1123194763 14:106605989-106606011 TGACCCGGCCTCGGGCTCTGTGG + Intergenic
1202898526 14_GL000194v1_random:23224-23246 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1123412993 15:20074385-20074407 TGCCCGGGCCGCGTGCCCTCGGG + Intergenic
1123522335 15:21081498-21081520 TGCCCGGGCCGCGTGCCCTCGGG + Intergenic
1124500420 15:30223241-30223263 GGCCCCCGCGCCGGGCCCTCGGG - Intergenic
1124743153 15:32315425-32315447 GGCCCCCGCGCCGGGCCCTCGGG + Intergenic
1125200734 15:37099009-37099031 GGCCCCAGCGGCGGCCCCGGCGG + Intronic
1125834268 15:42736510-42736532 TGCCCCCGCGGCGGGCCAGAGGG + Exonic
1127606312 15:60591834-60591856 TGCCCGGCCGGCGGCCGCTGAGG + Intronic
1127606359 15:60591981-60592003 TGTCCCGGGTGCGGGCCCTGGGG + Intronic
1128103934 15:65029332-65029354 CGCCCGGGCGGCCGGCCCCGAGG - Intronic
1131199983 15:90388186-90388208 TGCCGCTGGGGCGGGGCCTGCGG + Intergenic
1132205780 15:99985125-99985147 TGGCCCAGCGGCGGGCTCTGTGG + Intronic
1132556237 16:573951-573973 TGCCCCGACCTGGGGCCCTGTGG + Intronic
1132591124 16:726945-726967 CGCACCGCCGGCGGGCCTTGTGG + Intronic
1132776034 16:1594710-1594732 GGCCCCGCCGGCTGTCCCTGTGG - Intronic
1133001280 16:2852896-2852918 TGCCTTGGAGGCGGGGCCTGAGG + Exonic
1133021294 16:2968038-2968060 CTCGCCGGCGGCGGGCCCAGCGG - Exonic
1133125479 16:3643196-3643218 TGCCGAGGCGGCTGGACCTGAGG + Intronic
1133188363 16:4116062-4116084 GCCCGCGGCGGCGGGCGCTGGGG + Exonic
1134438836 16:14285638-14285660 TGCCCCGCCCGCGGGACCTGCGG + Intergenic
1135382764 16:22008218-22008240 GGCCCCGGCGGCGGCCCATGGGG + Exonic
1136235060 16:28908643-28908665 TGCTCCTGCTGCGAGCCCTGGGG + Exonic
1138551962 16:57753205-57753227 TGCGCCGGAGGGGGGCGCTGGGG - Exonic
1139594494 16:67950001-67950023 AGCCCCCAAGGCGGGCCCTGGGG - Intronic
1140478763 16:75251533-75251555 TGCCCGGGCCGCGTGCCCTCGGG + Intronic
1141701154 16:85642733-85642755 TGCAGCGGGGCCGGGCCCTGGGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1144991565 17:19237335-19237357 GGCCTCGGGGGCGGGGCCTGAGG + Exonic
1148603041 17:48908542-48908564 CGCCGGGGCGGCGGGCCCCGGGG + Exonic
1151224886 17:72640613-72640635 CGCCCAGTCGGCGGGGCCTGCGG - Intergenic
1157354162 18:46917689-46917711 CTCCCCGGCGGAGGCCCCTGCGG + Intronic
1159241728 18:65750903-65750925 TGCCCCGGCCTCGGGCGCCGGGG - Exonic
1160340364 18:78084225-78084247 TGCCCTGGCTGAAGGCCCTGGGG + Intergenic
1160719275 19:590285-590307 GGCCCCCGCGCCGGGCCCTCGGG - Exonic
1160935481 19:1592653-1592675 GGCGGCGGCGGCGGGCCCGGCGG - Exonic
1161165254 19:2783301-2783323 TGCGCAGGCGTCGCGCCCTGGGG - Exonic
1161620109 19:5293180-5293202 AGCGGCTGCGGCGGGCCCTGTGG - Intronic
1161707264 19:5828022-5828044 TGCGCCAGCGGCGGCGCCTGCGG + Exonic
1162903397 19:13808839-13808861 TGCGCCGGCGGTGGGGTCTGGGG - Exonic
1163146163 19:15380266-15380288 GGCCCCGGGGGCTGGCTCTGGGG + Exonic
1163189634 19:15667091-15667113 GCCCCAGGCGGCAGGCCCTGTGG - Intergenic
1163851812 19:19668711-19668733 AGCCCCAGGGGCGGGACCTGGGG + Intergenic
1165311260 19:35030608-35030630 TGCCCGGACGCCGGGCCCCGGGG + Intergenic
1165578007 19:36838280-36838302 AGCCCCGGCCTCGGGCCCTCCGG + Intronic
1165850967 19:38850050-38850072 TCCCCCCGCGGCGGGACCAGTGG - Exonic
1166827092 19:45616469-45616491 TGCCCAGGCGGCTGACCTTGCGG + Exonic
1167312945 19:48747575-48747597 AGCCACCGCGCCGGGCCCTGAGG - Intergenic
1167455524 19:49595412-49595434 TGGCCGGGCCACGGGCCCTGAGG + Exonic
1167752464 19:51389121-51389143 GGGCCGGGCGGGGGGCCCTGGGG - Exonic
1168247013 19:55117507-55117529 TGGCCCGGCGGCTGGCCCGGGGG - Exonic
1168722751 19:58563244-58563266 GGCCCCGGCTCCGGCCCCTGGGG + Exonic
925201070 2:1968111-1968133 GGGCCCAGCTGCGGGCCCTGGGG - Intronic
925846938 2:8043124-8043146 TGCCCAGGCAGAGAGCCCTGGGG + Intergenic
926397025 2:12453940-12453962 TGTCCCGGCGGGGGGGCCTCGGG + Intergenic
926718621 2:15942697-15942719 TGCCCCGGCGGCGGGCCCTGCGG + Exonic
927215838 2:20667398-20667420 TGCCCAGGCTGCGGGCGCCGCGG + Exonic
927936665 2:27080086-27080108 TGCCCTGGAGGAGGGCCCAGGGG - Intronic
929983202 2:46699529-46699551 TGCGCCGGGCGCGGGCACTGGGG - Intronic
932620252 2:73260783-73260805 GGCCCCACCTGCGGGCCCTGGGG - Exonic
932700016 2:73985507-73985529 CGCTCCGGCGGCGGGCGCGGCGG + Intergenic
933985114 2:87584377-87584399 AGCACCGGCGGCGCGCGCTGCGG - Intergenic
934661406 2:96145472-96145494 TGCCCCGGAGGCCGGCCCACGGG - Intergenic
934777147 2:96946753-96946775 TGCCGCAGAGGCGGCCCCTGGGG + Intronic
936308727 2:111366434-111366456 AGCACCGGCGGCGCGCGCTGCGG + Intergenic
937999398 2:127720031-127720053 AACCCCTGGGGCGGGCCCTGGGG + Exonic
938058080 2:128232243-128232265 CGCCACGGCGCCCGGCCCTGTGG + Intergenic
938440857 2:131331159-131331181 GGCGGCGGCGGCGGGCGCTGGGG + Intronic
938489551 2:131754604-131754626 AGCCCCTGCGCTGGGCCCTGGGG + Intronic
941808529 2:169733842-169733864 TCCCCCGTCGCCGGGCCGTGCGG - Exonic
944221685 2:197310294-197310316 TGCGGCGGCCGCGGGCCCGGCGG - Intronic
945032904 2:205682141-205682163 GGCCAAGGCGGCGCGCCCTGGGG + Intronic
945403979 2:209423720-209423742 TGCCCGGGCGGCGGGACAGGCGG - Intergenic
946397264 2:219449213-219449235 TGCCCTGGCTGCGGGCCCCTCGG - Exonic
948405747 2:237717581-237717603 TGCACGGGTGGCGGTCCCTGTGG + Intronic
948515880 2:238503687-238503709 CGCCCAGGCAGCTGGCCCTGTGG + Intergenic
948606186 2:239137213-239137235 TGCCTCGGGGCCGAGCCCTGCGG + Intronic
948808228 2:240462036-240462058 TGCAGCGGCTGTGGGCCCTGTGG - Intronic
948874723 2:240820421-240820443 TGACACCGCGGCGGGCCCCGCGG + Intergenic
948893851 2:240919217-240919239 TGCCCCTGAGGGTGGCCCTGTGG - Intronic
949004581 2:241637843-241637865 GGCCGGGGCGGCGGGCGCTGCGG + Intronic
949019781 2:241734648-241734670 TGGGCCTGCGGCGGGCGCTGCGG + Exonic
1169073727 20:2749487-2749509 GGTCCAGGCGGCGCGCCCTGCGG - Exonic
1170889995 20:20368505-20368527 TGCGCGGCCCGCGGGCCCTGCGG - Exonic
1171567398 20:26208311-26208333 GGCCCCGGTGGCGGGACCAGGGG - Intergenic
1172143918 20:32743283-32743305 GGGCCCGGCGGCGGGGCGTGGGG - Intronic
1172224916 20:33299192-33299214 TGCCCCGAGGACGGGCCCGGAGG + Intronic
1172287185 20:33749049-33749071 TGCACAGGTGGGGGGCCCTGGGG - Exonic
1175399702 20:58693228-58693250 CGCACCGGCGACGGGGCCTGGGG - Intronic
1176030531 20:63009152-63009174 GGCCCCTGCTGCGGCCCCTGCGG + Intergenic
1176113960 20:63423002-63423024 CGCCCCTGCTGCTGGCCCTGAGG - Intronic
1176247935 20:64106103-64106125 TGCGCAGGCTGCGGGCCGTGCGG - Exonic
1176550186 21:8217409-8217431 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1176569114 21:8400447-8400469 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1176577028 21:8444679-8444701 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1176618208 21:9039214-9039236 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1176706633 21:10123244-10123266 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1176722269 21:10402310-10402332 TGCCCCAGCGGAGGGCCCTGGGG + Intergenic
1178561625 21:33643264-33643286 CGGCCCCGCGGCGCGCCCTGGGG - Intronic
1179150554 21:38805561-38805583 TCCCTCGCCGGCTGGCCCTGAGG - Exonic
1180303453 22:11055072-11055094 TGCCCCAGCAGAGGGCCCTGGGG + Intergenic
1180674949 22:17580754-17580776 TGCCCTGGTGGCGGCCCATGGGG + Intronic
1182576435 22:31276463-31276485 AGCCCCGGCGGCGGCCGCAGGGG + Intronic
1183466719 22:37983823-37983845 GACCCCGGCGGCTGGCCCGGGGG - Exonic
1183524741 22:38316717-38316739 GGCCCCGGCGCCCGGACCTGGGG - Intronic
1183578254 22:38706157-38706179 GGCGGCGGCGGCGGGCGCTGAGG + Intronic
1184210941 22:43035297-43035319 TGCCCCAGTGGAGGGCCCTGGGG - Intergenic
1184472154 22:44702175-44702197 GGACCCGGGGGCGGGCCCAGGGG - Intronic
1203255081 22_KI270733v1_random:133747-133769 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1203263137 22_KI270733v1_random:178826-178848 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
950467424 3:13163499-13163521 TGCCCCAGCCACGGGGCCTGAGG - Intergenic
950569601 3:13791913-13791935 TGCCCTGGGGGCTGACCCTGGGG + Intergenic
953656854 3:44861462-44861484 TGCCTCGGCAGAGGGCGCTGGGG - Intronic
955325924 3:58009203-58009225 GTCCCCGGGGGCGGGCCCTAGGG + Intronic
956675040 3:71725329-71725351 GGCCCCGGCGGGGGGCGCGGCGG + Exonic
956678026 3:71753680-71753702 AGCGGCGGCGGCGGGCCCGGCGG + Intronic
956818301 3:72928980-72929002 TGGAGCGGCGGCGGGCCTTGGGG - Intronic
961331906 3:126147501-126147523 TGCCCAGCCAGCTGGCCCTGTGG + Intronic
963798752 3:149657263-149657285 TGCCCAGGCGGCGGGAGCGGAGG + Exonic
964358283 3:155870368-155870390 CGCCCCGGAGGAGGGGCCTGTGG - Intergenic
966808664 3:183825282-183825304 CGCCCCGGCGGCGGATCCTTGGG + Exonic
966900564 3:184481075-184481097 TGACCAGGTGGCAGGCCCTGGGG + Intronic
967978045 3:195046346-195046368 AGCCCTGGCTGCTGGCCCTGGGG - Intergenic
968449125 4:666911-666933 GGCCACGGCGGAGGGCACTGAGG - Intronic
968572128 4:1347342-1347364 AGCGCCGGCGGCGGGGCCGGAGG + Exonic
968765938 4:2469191-2469213 TGCGCCGGCGGTGGCGCCTGCGG + Intronic
968775380 4:2536812-2536834 GGCCGCGGCGGCGGGCGCTCCGG - Intronic
968809352 4:2793043-2793065 TGCGGCGGCGGCGGGTCCCGCGG + Intronic
969488448 4:7485469-7485491 AGGCCCGGCAGGGGGCCCTGGGG - Intronic
969715949 4:8868208-8868230 TGGCCCGGCGGCCGGCACGGAGG - Exonic
984778917 4:183506045-183506067 CGCGCCGGGGGCGGGGCCTGCGG + Intronic
985451767 4:190066809-190066831 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
985452755 4:190070101-190070123 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
985453741 4:190073394-190073416 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
985454730 4:190076687-190076709 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
985455720 4:190079984-190080006 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
985456703 4:190083278-190083300 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
985457690 4:190086574-190086596 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
985458678 4:190089871-190089893 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
985459667 4:190093171-190093193 TGCCCCGCCGGCCGGCGCGGCGG - Intergenic
986132232 5:4942360-4942382 TGCCCAGGCTGCAGGGCCTGGGG + Intergenic
986333275 5:6733786-6733808 TGCGCTGGCGGCGTGGCCTGTGG + Intronic
1000014581 5:157266134-157266156 CGCCCCGGCGCGGGGCCCTGCGG + Exonic
1002160659 5:177312284-177312306 TGCCGCGGGGGCGGGGCCTCCGG + Exonic
1002547844 5:179963048-179963070 AGCCCCGGCGGCCGTGCCTGTGG - Intronic
1003187953 6:3849333-3849355 TGGCGGGGAGGCGGGCCCTGAGG - Intergenic
1003269293 6:4593142-4593164 TGCCCCAGAGCCAGGCCCTGCGG - Intergenic
1003873557 6:10419179-10419201 TTCCCCGGCGCCGGGCCCCGCGG + Intronic
1004671225 6:17799322-17799344 TGCCCCGGTGGTGGACCCCGAGG - Exonic
1006454310 6:34123215-34123237 TGGCCCTGCTGCGGGCGCTGGGG - Intronic
1008014310 6:46501251-46501273 GGCCCCTGTGGCGGGACCTGTGG - Intergenic
1010141965 6:72622411-72622433 TGCCCCGGCGGCTCTCCCTCAGG - Exonic
1015437064 6:133201894-133201916 TGCCCAGGAAGCCGGCCCTGTGG + Intergenic
1016662600 6:146598898-146598920 GGCCCTGGGGGCGGGCTCTGCGG - Intergenic
1017842406 6:158232394-158232416 TGCCCCTGCGGTGGGCCCCGGGG + Intronic
1018810799 6:167296483-167296505 TGCCCCTGCGGAGGCACCTGTGG - Intronic
1019199951 6:170306339-170306361 GGCCCAGGCGGGTGGCCCTGAGG - Intronic
1019599601 7:1874722-1874744 TGCCCAGGCGGGAGGGCCTGTGG - Intronic
1023909054 7:44541082-44541104 TGCCCAGCCCGCAGGCCCTGAGG + Intronic
1024948219 7:54833314-54833336 TGGCCAGGCGCCCGGCCCTGCGG + Intergenic
1026923667 7:74174302-74174324 AGCCCCGGCGGCGGGGCGGGGGG + Exonic
1034979523 7:155467219-155467241 TGCCCCGGCGCCGGGCCTCCGGG + Intergenic
1035631620 8:1111063-1111085 AGCCCCGGAGTCGGGCACTGTGG - Intergenic
1036454293 8:8893691-8893713 CGCCCCGGGGGCGGGAGCTGCGG + Intergenic
1037580946 8:20245755-20245777 TGCCCCACCAGGGGGCCCTGGGG + Intergenic
1038017819 8:23529674-23529696 TGGCCCGGCCGCGCGCCCTCGGG + Intronic
1038436720 8:27541576-27541598 AGCCCCGCGGGCGGGTCCTGGGG - Intronic
1038612567 8:29069607-29069629 TGCCCAGGTGGAGGGTCCTGGGG - Exonic
1038798285 8:30728001-30728023 CGCCCCGGTGGCGGAGCCTGAGG + Intergenic
1039542228 8:38381974-38381996 TGCCATGGCGGCCGGCACTGAGG + Exonic
1039554829 8:38468191-38468213 TGCCCCGGAGGCGGGGCGGGGGG + Intronic
1042695159 8:71547630-71547652 TGCCCCGGGGTGGGGCCCAGGGG + Exonic
1043463988 8:80487049-80487071 GGCGCCGGCGGCCGGCCCGGCGG - Exonic
1044340421 8:91040753-91040775 TGCGGCAGCGGCGGGGCCTGGGG + Exonic
1046890456 8:119416271-119416293 GGCCCCGGCGCCGCGCCCTAAGG + Intergenic
1049379273 8:142303933-142303955 TGCCCCTGCCGAGGGGCCTGAGG - Intronic
1049782639 8:144435876-144435898 TGCCCCGGGGGCGGGGCCGGCGG + Exonic
1053482217 9:38424168-38424190 GGCCGCGCCGGCGGGCGCTGTGG - Exonic
1053643928 9:40110364-40110386 AGCCCCTGCGCTGGGCCCTGGGG + Intergenic
1053762224 9:41355125-41355147 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1054540821 9:66266245-66266267 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic
1057282036 9:93720176-93720198 TGCCCAGGTGGCATGCCCTGGGG - Intergenic
1057773163 9:97984465-97984487 TGCCGCGGCGGCGGCGCCCGGGG + Intronic
1060700493 9:125746605-125746627 CGCCCCGGGGGCGGGGTCTGAGG + Intergenic
1061570997 9:131477390-131477412 TGCCCTGCCGGAGGGCCCTTGGG - Intronic
1061680612 9:132241059-132241081 TCCCCCGTGGGCGGGGCCTGCGG + Intronic
1061828513 9:133275794-133275816 GGCGCCCGCGCCGGGCCCTGAGG + Intergenic
1203760931 EBV:12786-12808 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203761860 EBV:15858-15880 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203762789 EBV:18930-18952 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203763718 EBV:22002-22024 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203764647 EBV:25074-25096 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203765576 EBV:28146-28168 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203766505 EBV:31218-31240 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203767434 EBV:34290-34312 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203471479 Un_GL000220v1:116884-116906 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1203479300 Un_GL000220v1:160856-160878 GGCCCCGGGGGCGGACCCGGCGG - Intergenic
1185736895 X:2501613-2501635 TGCCCCAGTGGGGGGGCCTGTGG - Intronic
1190322323 X:49186426-49186448 ATGCCCGGGGGCGGGCCCTGCGG - Intronic
1190337197 X:49269823-49269845 GGCACCGGCGGCGGGACCGGCGG - Intronic
1196707340 X:118727684-118727706 TGCGCCGGCGGCGGGGGCGGGGG + Exonic
1198936246 X:141904457-141904479 TACCACGGGGGCGGTCCCTGTGG - Intronic
1200068739 X:153517667-153517689 TGCACCGGCGGCGGGCGACGCGG - Intronic
1200093576 X:153647128-153647150 GGCTCCGGGGGCGGGCCCGGCGG - Intronic
1200118342 X:153778943-153778965 TGCCCTGGAGGAGGACCCTGTGG + Exonic
1201151597 Y:11098051-11098073 AGCCCCTGCGCTGGGCCCTGGGG - Intergenic