ID: 926719261

View in Genome Browser
Species Human (GRCh38)
Location 2:15947108-15947130
Sequence GGATTGTACAGGTGCAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926719261_926719273 19 Left 926719261 2:15947108-15947130 CCCTTTTTGCACCTGTACAATCC 0: 1
1: 1
2: 0
3: 25
4: 239
Right 926719273 2:15947150-15947172 ATTGTCCCCACTTAAGGTGGAGG 0: 1
1: 1
2: 0
3: 2
4: 90
926719261_926719272 16 Left 926719261 2:15947108-15947130 CCCTTTTTGCACCTGTACAATCC 0: 1
1: 1
2: 0
3: 25
4: 239
Right 926719272 2:15947147-15947169 GTCATTGTCCCCACTTAAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 87
926719261_926719271 13 Left 926719261 2:15947108-15947130 CCCTTTTTGCACCTGTACAATCC 0: 1
1: 1
2: 0
3: 25
4: 239
Right 926719271 2:15947144-15947166 TGAGTCATTGTCCCCACTTAAGG 0: 1
1: 0
2: 1
3: 15
4: 91
926719261_926719274 20 Left 926719261 2:15947108-15947130 CCCTTTTTGCACCTGTACAATCC 0: 1
1: 1
2: 0
3: 25
4: 239
Right 926719274 2:15947151-15947173 TTGTCCCCACTTAAGGTGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926719261 Original CRISPR GGATTGTACAGGTGCAAAAA GGG (reversed) Intergenic
901048717 1:6415164-6415186 GGAGTGTAGTGGTGCAATAATGG - Intronic
901134518 1:6984274-6984296 GCATTGTAAAAGTGCATAAAGGG + Intronic
901134707 1:6985425-6985447 GCATTGTAAAAGTGCATAAAGGG - Intronic
901269908 1:7943828-7943850 GGAGTGCACAGGTGCAAACATGG - Intergenic
904855138 1:33492178-33492200 TCATTGTAAAGGTGCAAACATGG + Intronic
909377736 1:74959307-74959329 GGAGTGCACTGGTGCAATAATGG - Intergenic
910299879 1:85694042-85694064 GAAATGTACAGGGGGAAAAAAGG + Intronic
911374033 1:97028561-97028583 GCATGGTACAGGTACAAAAATGG + Intergenic
911431086 1:97788309-97788331 GGATTCTAAAGGAGCAAAAGTGG - Intronic
912766334 1:112415138-112415160 GGAGTGTAGTGGTGCAAACACGG - Intronic
913143874 1:115969898-115969920 ACATTTTGCAGGTGCAAAAAAGG - Intergenic
913400481 1:118426744-118426766 GAATACTACAGGTGGAAAAATGG + Intergenic
913998807 1:143675047-143675069 GGAGTGTACTGGTGCAAACAAGG + Intergenic
915263945 1:154701323-154701345 ATATTGTACAGGTGCAAACCAGG - Exonic
918570028 1:185979211-185979233 TGAATGTCCAGGTGAAAAAATGG + Intronic
918745608 1:188194915-188194937 GGATTTTGCAGATGCAAATAAGG + Intergenic
919721157 1:200837436-200837458 GCATGGTACTGGTACAAAAATGG - Intronic
919857660 1:201716825-201716847 GGAGTGTAGTGGTGCAAACACGG - Intronic
920951147 1:210572843-210572865 GGAATGTACTGGTGCAATCATGG - Intronic
921600951 1:217105722-217105744 TGATTGTCCAGGTGCAGAATGGG - Intronic
1063297414 10:4821005-4821027 GGATTATACATGTACAAAAAGGG - Intronic
1064632343 10:17329254-17329276 GTATTTTACAGATGCGAAAATGG + Intronic
1064693760 10:17944839-17944861 GCATTGTACTGGTACCAAAACGG - Intergenic
1065218327 10:23472027-23472049 GGTTTGTGCATATGCAAAAAAGG - Intergenic
1065621225 10:27584188-27584210 GAATAGTGCAGGTGTAAAAAGGG + Intergenic
1066356705 10:34691719-34691741 GCATGGTACTGGTACAAAAATGG + Intronic
1068150567 10:53125449-53125471 GGAATGTATAGGAGAAAAAAAGG + Intergenic
1068198592 10:53751140-53751162 GGATTTTACAGGTGGAAACAAGG - Intergenic
1068718261 10:60212328-60212350 GATTTGTAAAGGAGCAAAAAGGG + Intronic
1069296884 10:66857265-66857287 GCATGGTACTGGTACAAAAACGG - Intronic
1070368123 10:75755968-75755990 GGATTGTAGAGGAGCAAGAGTGG + Intronic
1071400374 10:85262778-85262800 GGATTGTAGAGGTGCAATCTTGG - Intergenic
1073796111 10:106990042-106990064 TTATTGAACAGGTGCAAAGAAGG + Intronic
1075340366 10:121642909-121642931 CCATTTTACAGATGCAAAAACGG - Intergenic
1077762761 11:5121492-5121514 GCATTGTACAGATTCAAAACCGG + Intergenic
1077833862 11:5905954-5905976 GCATTGTACTGGTATAAAAACGG - Intronic
1079697405 11:23498945-23498967 TGATTGTAAAGGTGAAGAAATGG + Intergenic
1080433730 11:32221202-32221224 GGAATGCCCAGGTGCAAAGAGGG - Intergenic
1080550944 11:33373850-33373872 CAATTGTCCAGGTGCAGAAAAGG + Intergenic
1080695355 11:34599122-34599144 GAATTTTACTGGTGTAAAAATGG + Intergenic
1082740162 11:56902024-56902046 GGGTTGTACAGATGTAAGAAAGG - Intergenic
1082878480 11:58013925-58013947 GCATAGTACTGGTACAAAAACGG + Intergenic
1084949231 11:72655436-72655458 GGATGGTACAAGAGCCAAAATGG + Intronic
1085581870 11:77658188-77658210 GGACAGTACAGGTTCAAATAAGG + Intergenic
1085590482 11:77755189-77755211 GGATTGCAGAGGAGCAAGAAGGG + Intronic
1085681309 11:78577644-78577666 GAAGTGGACATGTGCAAAAAGGG - Intergenic
1085985837 11:81786810-81786832 AGATTTTACAAGTGCAAATAAGG - Intergenic
1092327508 12:7548712-7548734 GCATTGTACTGGTACCAAAACGG + Intergenic
1093068634 12:14685478-14685500 AGATTGAACAGGTACAAAAAAGG + Intronic
1093436318 12:19139002-19139024 GGATTGGACAGGAGCAAAGTGGG + Intronic
1094404159 12:30097039-30097061 GGATTTTACAGATGTCAAAAAGG + Intergenic
1094442507 12:30494423-30494445 GGAATTTCCTGGTGCAAAAATGG - Intergenic
1095816463 12:46427909-46427931 GCATGGTACTGGTACAAAAATGG + Intergenic
1099395026 12:82127351-82127373 GCATGGTACTGGTACAAAAACGG + Intergenic
1102572149 12:113833369-113833391 GCATTGTAGAGGGGCAAGAATGG - Intronic
1103208863 12:119152194-119152216 TGATTGTATAGTTGCAAAAGAGG - Intronic
1106788746 13:33132804-33132826 TAATTGTACAAGTGGAAAAAGGG + Intronic
1107168226 13:37308450-37308472 GAAGTGTAAAGGTGAAAAAAAGG + Intergenic
1107181724 13:37469222-37469244 GGATTGTGCAGGTGCAATTAAGG + Intergenic
1108227271 13:48303143-48303165 GGATTGTAGTGGTGTAAGAACGG - Intergenic
1108549839 13:51532919-51532941 GGATTCTCCAGTTGCAACAACGG - Intergenic
1109486122 13:63022353-63022375 GGAGTGCACTGGTGCAAACATGG - Intergenic
1110886231 13:80639706-80639728 GCATGGTACTGGTACAAAAATGG + Intergenic
1112926115 13:104677488-104677510 GGATTTTGCAGGTACAAAACAGG + Intergenic
1115876738 14:37869688-37869710 GGATAGCACAGGGGCAAGAATGG + Intronic
1116291381 14:43046879-43046901 GGATTGTAGATGAGCAAGAATGG - Intergenic
1117066581 14:52017713-52017735 AGATTTTAAAGGTCCAAAAAAGG - Intronic
1118114975 14:62765150-62765172 GCATTGTACTGGTACAAAAATGG + Intronic
1118451146 14:65903566-65903588 GGATTCTACAGATGCAATTAAGG + Intergenic
1119132871 14:72190826-72190848 GGATTGAACAGCTGGAAAAGAGG - Intronic
1119663032 14:76465131-76465153 GAATTTTACAGGTGACAAAATGG + Intronic
1119978729 14:79055373-79055395 CGACTGTACAGGTGAATAAATGG + Intronic
1120561732 14:86002108-86002130 GGAGTGCAGTGGTGCAAAAAAGG + Intergenic
1121898316 14:97669764-97669786 GGAGTGTAGTGGTGCAAACATGG + Intergenic
1122007376 14:98716572-98716594 TGATTTTACAGGGGCAGAAAAGG - Intronic
1123973498 15:25530840-25530862 GGACTGCAAAGGTGCAACAAAGG - Intergenic
1124981444 15:34571260-34571282 GGATTGCAGCGGTGCAAACACGG - Intronic
1125346064 15:38720299-38720321 GGCTTGTACAAGTTCAAAATGGG - Intergenic
1126127506 15:45309071-45309093 GGAGTGTAGTGGTGCAAACATGG - Intergenic
1126308504 15:47288794-47288816 GGAGTGTACAGGTGGAAGGACGG - Intronic
1127216479 15:56828486-56828508 AGATTATACAGAGGCAAAAAGGG + Intronic
1129339355 15:74874819-74874841 GGAGTGTAGTGGTGCAAAGATGG - Intergenic
1130827971 15:87568918-87568940 GGATTGTACAAGTGCCAATCTGG - Intergenic
1131529669 15:93180598-93180620 GCAATGTACAGGTGCAGAAATGG + Intergenic
1131549172 15:93341933-93341955 GGATTGAACAGCTGAAAAGAGGG + Intergenic
1134103234 16:11467559-11467581 GGAGTGCAGAGGTGCAAACATGG - Intronic
1135054567 16:19220167-19220189 GGAATGTAAAGGGGCAGAAATGG + Intronic
1138274535 16:55724067-55724089 GCATGGTACTGGTACAAAAATGG + Intergenic
1138301759 16:55936301-55936323 GGATTGCAGAGCTGCAAAGATGG - Intronic
1139554736 16:67700022-67700044 GAAGTGTAGTGGTGCAAAAATGG - Intronic
1143363254 17:6388353-6388375 GGATGGGACAGGAGCTAAAATGG + Intergenic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1146112030 17:30098479-30098501 GGAGTGTAGTGGTGCAAACATGG - Intronic
1146645722 17:34576423-34576445 TCATTTTACAGCTGCAAAAACGG - Exonic
1147382759 17:40065329-40065351 GGAGGGTACAGGTGGGAAAAAGG - Intronic
1148000493 17:44384685-44384707 GCATTGTGCAGATGGAAAAACGG + Intronic
1148004067 17:44411058-44411080 GGATTATAAATGTGCAGAAAAGG + Intronic
1148015278 17:44517444-44517466 GGATTGTAAGGGTGCAAGAATGG + Intergenic
1148386910 17:47240664-47240686 TGATTTTACAAGTGAAAAAATGG - Intergenic
1148571182 17:48670608-48670630 GGAGTGCACTGGTGCAAACACGG + Intergenic
1149128273 17:53262360-53262382 CCATTGAACAGGTGCAAAAATGG + Intergenic
1149503893 17:57176931-57176953 AGATTATACAGCTGCTAAAAAGG + Intergenic
1150717036 17:67580996-67581018 GGAGTGTAGAGGTGCAAACATGG - Intronic
1152762457 17:82116232-82116254 GGATGGTTTAGGAGCAAAAATGG - Intronic
1156409108 18:36810911-36810933 GGATTGTCCAGGAGTAGAAAAGG - Intronic
1156865892 18:41888347-41888369 GGATTGGACAGAAGCAAAAATGG - Intergenic
1156907910 18:42376800-42376822 GCATAGTACTGGTACAAAAATGG - Intergenic
1157443817 18:47729951-47729973 GGATTGTCGAGGTGGAAAGACGG + Intergenic
1158167494 18:54556969-54556991 GGATTGTAGAAGTGGAAATAGGG + Intergenic
1161165954 19:2787559-2787581 GGATTTTAGAACTGCAAAAAAGG - Intronic
1161588988 19:5120266-5120288 GGAGTGCAGAGGTGCAAACACGG - Intronic
1162466294 19:10843117-10843139 GGATTGTGAGTGTGCAAAAAAGG + Intronic
1165003998 19:32789331-32789353 GAATTGTACACTTGAAAAAAGGG - Intronic
1165435500 19:35792712-35792734 GGACTGAACAGGGACAAAAAGGG + Intergenic
1166430167 19:42718930-42718952 GCATGGTACAGGTACCAAAACGG + Intronic
925394283 2:3521248-3521270 GGATTGCACTGGGGCAAAAATGG - Intergenic
925447012 2:3935550-3935572 GCATGGTACTGGTACAAAAACGG - Intergenic
926719261 2:15947108-15947130 GGATTGTACAGGTGCAAAAAGGG - Intergenic
927266157 2:21153458-21153480 GCATGGTACTGGTACAAAAATGG + Intergenic
928346004 2:30496548-30496570 GAATTTTACAGATGAAAAAATGG - Intronic
931502874 2:62889812-62889834 GCATGGTACTGGTACAAAAATGG - Intronic
932558280 2:72844613-72844635 GGATTTTACAGATTGAAAAATGG - Intergenic
932585034 2:73022382-73022404 TGAATGTAGAGGTGCAAATATGG + Intronic
934882256 2:97994749-97994771 GTATTGTACTGCTGCAAAACGGG - Intronic
935314952 2:101823590-101823612 GGTTTGTTCAGCTGTAAAAATGG - Intronic
938523606 2:132100228-132100250 TGTCTGTACAGGTACAAAAAAGG - Intergenic
938962113 2:136353366-136353388 GGTTTGCACAGGTGGAAAACAGG - Intergenic
938990270 2:136620910-136620932 GCATGGTACTGGTACAAAAATGG - Intergenic
940096227 2:149978889-149978911 GGATTGATCAGGTGGAAGAAAGG + Intergenic
941615419 2:167713033-167713055 GGATTTTGCAGGTGCACACATGG + Intergenic
941880605 2:170476684-170476706 GGTTTGTATGGGTGCAAAATAGG + Intronic
942631241 2:177951887-177951909 GGATTGTTTAGGGGAAAAAAAGG + Intronic
942657291 2:178227154-178227176 GTATTTTACAGTTACAAAAAAGG + Intronic
945217040 2:207444849-207444871 GAACTGTACAGGTGTCAAAAAGG - Intergenic
945249317 2:207750665-207750687 GAATTGTACAGCTGCACTAATGG + Intronic
945688493 2:213003469-213003491 GGATTGTTCACGTCCAAAAATGG - Intronic
947059058 2:226141490-226141512 TGATTATACAGATACAAAAAAGG + Intergenic
947597198 2:231420523-231420545 GGAGTGTAGTGGTGCAAACATGG - Intergenic
1171367820 20:24638236-24638258 GGATGCTGCAGGTGCAAAATCGG + Intronic
1173238339 20:41269481-41269503 GGATTCTAGAGGCACAAAAATGG + Intronic
1177956849 21:27608238-27608260 GTATGGTACTGGTACAAAAATGG - Intergenic
1178206385 21:30471792-30471814 GGTTTGTAGAGAAGCAAAAAGGG + Intergenic
1179436551 21:41366282-41366304 GTGATATACAGGTGCAAAAAGGG - Intronic
1180021835 21:45133491-45133513 GGATTTTACAGATGCAATTAAGG - Intronic
949498932 3:4659970-4659992 TGATAGTACAGGTGCAAATGAGG - Intronic
949856794 3:8469292-8469314 GCACTGTCCAGGAGCAAAAAGGG + Intergenic
951015244 3:17724452-17724474 TGACTATACAGGGGCAAAAATGG - Intronic
952549238 3:34457178-34457200 GGAGTGTTCAGGTGCCAATAGGG + Intergenic
954394888 3:50288258-50288280 GCATTGTACAGGTGCTAGAGTGG + Exonic
956554821 3:70508273-70508295 GAATTCTACATCTGCAAAAATGG - Intergenic
957331600 3:78771259-78771281 GCATGGTACTGGTACAAAAATGG - Intronic
957346219 3:78964377-78964399 GGGGTGTACAGGGGCAGAAAGGG + Intronic
957813405 3:85258033-85258055 GAAATGTACAAGTGCAAAAAAGG + Intronic
958008549 3:87844990-87845012 GGCTTGTATAGATGCAGAAAAGG + Intergenic
958558075 3:95705274-95705296 TGATTGTACAGGCTCAAAAGTGG + Intergenic
959048868 3:101505012-101505034 GGAGTGCAGTGGTGCAAAAACGG - Intronic
960686069 3:120295116-120295138 GCATGGTACTGGTACAAAAACGG + Intergenic
962263272 3:133928202-133928224 GGATTTTACAGATTTAAAAAGGG + Exonic
962710632 3:138082774-138082796 GGAAACTACAGCTGCAAAAAAGG - Intronic
963295798 3:143545032-143545054 GTATTGTACCAGTACAAAAATGG - Intronic
964257944 3:154799042-154799064 TAATTGCACAGGTGGAAAAATGG - Intergenic
965117056 3:164503518-164503540 GGATGGTACTCGTACAAAAATGG - Intergenic
965494135 3:169376954-169376976 GCATGGTACTGGTGCCAAAACGG + Intronic
969117784 4:4883372-4883394 GGATTGTAGTGGTGCAATCATGG - Intergenic
970173438 4:13312050-13312072 GCATGGTACTGGTACAAAAACGG + Intergenic
971998583 4:33998688-33998710 GGTCTGTTCAGCTGCAAAAATGG - Intergenic
974010329 4:56600774-56600796 GCATTGTACAGGAGCAAGGATGG + Intronic
975102090 4:70525379-70525401 GGAATGAAAAGGCGCAAAAATGG - Intronic
977137142 4:93319522-93319544 GGATTTTACAGATGCAATTAAGG + Intronic
977330366 4:95629728-95629750 GGATTGGAGGGGTGCAAAAGTGG - Intergenic
978332890 4:107634066-107634088 GGAGTGCAGTGGTGCAAAAATGG + Intronic
978673770 4:111284239-111284261 GGATTTTCCAAGTGCTAAAAAGG + Intergenic
979621745 4:122805908-122805930 TGATTGTAATAGTGCAAAAAAGG + Intergenic
980011453 4:127599437-127599459 GGAAAGTACTGATGCAAAAAGGG + Intergenic
980060568 4:128124654-128124676 GGATTGTACAGGGACAAGAGTGG + Intronic
980062482 4:128146647-128146669 GGATTGGGCAGGGGCAAAAAGGG + Intronic
981280854 4:142956286-142956308 GGAGTGTAGAGGTGCAATCATGG - Intergenic
982368066 4:154602537-154602559 GGATTTTATAGGTTCACAAAGGG + Intergenic
984649855 4:182259361-182259383 GGAGTGTAGTGGTGCAAACATGG + Intronic
986909642 5:12538913-12538935 GCATGGTACTGGTACAAAAATGG + Intergenic
988123316 5:26995587-26995609 GGAATGTACAGGTGTTAAATTGG - Intronic
989585431 5:43070946-43070968 GGTTTGTGCATATGCAAAAAAGG - Intronic
990448156 5:55912168-55912190 GGATTATAGAGGATCAAAAATGG - Intronic
993353800 5:86881536-86881558 GGGCTGTGCAGGTGCAAGAAGGG - Intergenic
993511014 5:88771466-88771488 GGACTGTACAGGTACAGAAAAGG - Intronic
994228501 5:97283974-97283996 GCATGGTACTGGTACAAAAAAGG - Intergenic
994398753 5:99252234-99252256 GCATGGTACTGGTACAAAAATGG - Intergenic
995453713 5:112330688-112330710 GGATAGCACAGTTGCAAACATGG - Intronic
996039898 5:118797834-118797856 GGAGTGTAGTGGTGCAAACATGG - Intergenic
996159507 5:120145356-120145378 GGCTTTCACAGGTGCACAAAGGG - Intergenic
996762643 5:127001724-127001746 AGATTGTACAGGGACAAAAGTGG - Intronic
997115943 5:131125918-131125940 GCATGGTACTGGTACAAAAACGG + Intergenic
998681076 5:144468067-144468089 GGATTATAGAGGGGAAAAAAGGG - Intronic
999925053 5:156366434-156366456 GAAATGTACAGGTACTAAAAAGG + Intronic
1001874873 5:175191299-175191321 GGCTTTTACAGGTGCTAGAAGGG - Intergenic
1002807942 6:596041-596063 CCATTGTACAGGTGAAAACACGG - Intronic
1004563263 6:16771510-16771532 GGCTTGAACAGGTGGAAAGATGG - Intergenic
1005316557 6:24608546-24608568 GGATGGTACAGGTGCAAAAATGG + Intronic
1009845376 6:69127675-69127697 GGATTTTTGTGGTGCAAAAAAGG - Intronic
1010548670 6:77191897-77191919 GCATGGTACAGGTACAAAAACGG - Intergenic
1012722873 6:102769320-102769342 GTATGGTACTGGTACAAAAACGG + Intergenic
1013347456 6:109276000-109276022 GAATTATACAGTTGCAAAAAAGG - Intergenic
1014745097 6:125191556-125191578 GCATTGTAGATGTGCAAGAACGG + Intronic
1018353343 6:162986339-162986361 GCATTGTACTGGTATAAAAAAGG + Intronic
1018574037 6:165239680-165239702 GAATGGTACTGGTACAAAAATGG - Intergenic
1020277281 7:6632358-6632380 GAATTGTACTAGTGCAAAAAGGG + Intergenic
1020596720 7:10215384-10215406 AGGTTGCACAGGTGCAAAAAAGG - Intergenic
1022210268 7:28202070-28202092 GGATGGTACGGGTACAAAGATGG + Intergenic
1022394522 7:29974351-29974373 GAATTGGGCAGGTGTAAAAAAGG - Intronic
1027632091 7:80619594-80619616 GGAGTGCACTGGTGCAAAATAGG - Intronic
1027886567 7:83914555-83914577 GGATGGTACTGGTACAAAAATGG - Intergenic
1029516270 7:101025310-101025332 GGATTGCAGTGGTGCAAACATGG - Intronic
1029940609 7:104477039-104477061 GGAATGTAGTGGTGCAAACACGG + Intronic
1030961527 7:115929307-115929329 GCATTGTACTGGTACCAAAACGG + Intergenic
1031030306 7:116727207-116727229 GGATTGCACAATTACAAAAATGG - Intronic
1031344440 7:120648273-120648295 GGATAGTGCAGGTCAAAAAAAGG + Intronic
1031555705 7:123173522-123173544 GAATTGAAGAGGTGCAAAGAGGG - Intronic
1033176573 7:139129418-139129440 GGATGGTACTGGTACCAAAACGG + Intergenic
1033623319 7:143082669-143082691 GCATGGTACTGGTACAAAAATGG + Intergenic
1033978671 7:147135518-147135540 ATATTAAACAGGTGCAAAAAGGG + Intronic
1035179283 7:157077650-157077672 GGAGTGCAGTGGTGCAAAAATGG + Intergenic
1035869750 8:3124777-3124799 GGATTTATCAGGTGAAAAAATGG - Intronic
1039668419 8:39564690-39564712 GCATAGTACTGGTACAAAAACGG - Intergenic
1039848337 8:41342061-41342083 GGATTATACAGCTGTAAAGAGGG + Intergenic
1042350307 8:67770335-67770357 GGAATGTGCAGGTGCAATCAGGG - Intergenic
1042922373 8:73932481-73932503 GGAGTGTAGTGGTGCAATAATGG + Intergenic
1044236222 8:89833507-89833529 TGATTGTACCGGTGTAAAGAGGG - Intergenic
1044585275 8:93863930-93863952 GGAGTGTAGTGGTGCAAACATGG + Intronic
1045034239 8:98165072-98165094 GGTTTGCACAGGTGCTAGAATGG + Intergenic
1045328367 8:101134343-101134365 GCATTGTACAGCTGGCAAAAGGG + Intergenic
1046508119 8:115162328-115162350 GGATTTCACAGGTTCAAATAGGG + Intergenic
1046670799 8:117054147-117054169 GGAGTGCACTGGTGCAAATATGG + Intronic
1046887288 8:119381435-119381457 GCATTGTACTGGTACCAAAACGG + Intergenic
1047942995 8:129844593-129844615 CCATTTTACAGGTGGAAAAATGG - Intronic
1050199070 9:3122526-3122548 GTTTTGTACTGGTGCAAAATTGG - Intergenic
1051115803 9:13693174-13693196 GCATTGTACTGGTACAAAAACGG - Intergenic
1053414111 9:37935665-37935687 CCATTGTACAGATGCAGAAATGG + Intronic
1053702353 9:40707856-40707878 TGTCTGTACAGGTACAAAAAAGG - Intergenic
1053785393 9:41649292-41649314 CTATTTTACAGGTGCCAAAAAGG + Intergenic
1054159637 9:61664881-61664903 CTATTTTACAGGTGCCAAAAAGG - Intergenic
1054174118 9:61863244-61863266 CTATTTTACAGGTGCCAAAAAGG + Intergenic
1054412412 9:64831314-64831336 TGTCTGTACAGGTACAAAAAAGG - Intergenic
1054448975 9:65392311-65392333 CTATTTTACAGGTGCCAAAAAGG + Intergenic
1054663419 9:67717537-67717559 CTATTTTACAGGTGCCAAAAAGG - Intergenic
1056785279 9:89588196-89588218 TGATTGTACAGATGTTAAAAGGG + Intergenic
1057787100 9:98095580-98095602 GGGCTGTCCAGGTGCAAAACAGG - Intronic
1058643962 9:107113271-107113293 TGATTTTACAGATGAAAAAATGG + Intergenic
1060981671 9:127795994-127796016 CTATTTTACAGGTGGAAAAATGG - Intronic
1202799263 9_KI270719v1_random:159774-159796 AAATTGTACTGGTGCTAAAAAGG + Intergenic
1186716150 X:12254069-12254091 AGATTGGACAGGGGCAAAAGTGG + Intronic
1187537075 X:20151596-20151618 GGAATGTAAAGGTTCAGAAAAGG - Exonic
1187743773 X:22385783-22385805 GGAGTGTAGTGGTGCAAACATGG + Intergenic
1188452297 X:30320381-30320403 CCATTGTACAGGTGAATAAAAGG + Intergenic
1190585457 X:51935704-51935726 GTATGGTACTGGTACAAAAACGG - Intergenic
1192626720 X:72736375-72736397 GCATGGTATTGGTGCAAAAATGG - Intergenic
1192799135 X:74449256-74449278 TCATTGCACAGGTGCAGAAATGG - Intronic
1193193392 X:78600717-78600739 GCATGGTACTGGTACAAAAATGG + Intergenic
1193205133 X:78739297-78739319 TGATTTTACAGGTGCATAGATGG - Intergenic
1194053072 X:89096233-89096255 GGAGTGTACTGGTGCAATCATGG - Intergenic
1195540959 X:106062375-106062397 GCATGGTACTGGTACAAAAACGG - Intergenic
1195691214 X:107627300-107627322 AGCTTGTAAAAGTGCAAAAAAGG + Intergenic
1196219435 X:113094937-113094959 GGAGTGCAGAGGTGCAAACATGG - Intergenic
1198071480 X:133152576-133152598 GGAGTGTAGAGGTGCAATCATGG - Intergenic
1198368124 X:135963767-135963789 GAATTGTATAGGTGTAAAAAGGG - Exonic
1201239251 Y:11942387-11942409 GGAATGTAGTGGTGCAAACATGG - Intergenic
1201941885 Y:19468878-19468900 GCATGGTACAGGTACCAAAATGG - Intergenic