ID: 926719307

View in Genome Browser
Species Human (GRCh38)
Location 2:15947518-15947540
Sequence CAGAATAAACAGATGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 465}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926719307 Original CRISPR CAGAATAAACAGATGGAAAT GGG Intergenic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
902986529 1:20157763-20157785 CAGAGTGAAAAGATGGAAGTTGG + Intergenic
904874772 1:33645931-33645953 CAGACAAAACAGAAAGAAATGGG - Intronic
906882283 1:49604756-49604778 AAAAGTAAACAGAGGGAAATGGG - Intronic
907147092 1:52244827-52244849 AAGAACAAATACATGGAAATAGG - Intronic
907990082 1:59572337-59572359 AAGAATAAGCAGAAGGAAATTGG + Intronic
908129448 1:61059982-61060004 CAGAAGAGACAAATGGAAGTAGG + Intronic
908664427 1:66474212-66474234 TAGAAAAAAGAGATAGAAATTGG - Intergenic
908842111 1:68290535-68290557 CAGTATAACCAGGTGGAAAGAGG - Intergenic
909090810 1:71223067-71223089 TACAATATAAAGATGGAAATGGG + Intergenic
909426477 1:75531218-75531240 CAGATTAAACAGAGATAAATAGG - Intronic
912369271 1:109161108-109161130 CATAAGAAACACAGGGAAATAGG + Intronic
913024204 1:114819659-114819681 CAGAATATAGAGTTGGAAAAAGG - Intergenic
913088920 1:115463106-115463128 CAGAAGGAAAAGATGGAAAGAGG + Intergenic
913100458 1:115559348-115559370 GAGAAGAAAGAGATGGAGATTGG - Intergenic
913303859 1:117402521-117402543 AAGAATAAACAGATCAAAACAGG - Intronic
914313692 1:146489012-146489034 AATAATAAACAGAAGGAAAAGGG + Intergenic
914500657 1:148244369-148244391 AATAATAAACAGAAGGAAAAGGG - Intergenic
915027793 1:152848935-152848957 CAGCATGAACTGATGGATATTGG + Intergenic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916549840 1:165839716-165839738 CAGAAGAAACAGATTAAAAGTGG - Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917153603 1:171971190-171971212 GAGAAAAAACAAAAGGAAATAGG - Intronic
917174713 1:172220715-172220737 CAGAATGACCAGGTGGAATTTGG + Intronic
917219654 1:172715377-172715399 CAGAATTAACAGTTGTAAACAGG + Intergenic
917347183 1:174040301-174040323 CAAAAGAAATAGATGAAAATGGG + Intergenic
917606048 1:176630653-176630675 GAGAAAAAAAAGATGGATATAGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919381533 1:196867278-196867300 AAAAAAAAACAGAAGGAAATGGG - Intronic
919977470 1:202622117-202622139 CAAAGTAATGAGATGGAAATAGG + Intronic
920579665 1:207094635-207094657 CAGAATAAACAGAAAGAATCTGG - Intronic
920618257 1:207516708-207516730 CAGAATAAAGATAATGAAATAGG - Intronic
922255086 1:223886791-223886813 CAGAGTAAACAGGTGGAGATGGG - Intergenic
922992495 1:229926341-229926363 CAGAATAGTAAGATTGAAATGGG - Intergenic
923018532 1:230145462-230145484 CAACAAAAACAGAGGGAAATGGG - Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063020321 10:2120334-2120356 CAAAGTTAACAGAGGGAAATAGG - Intergenic
1064165068 10:12978747-12978769 CAGAATAAGGAAATGGAAAGAGG + Intronic
1065002467 10:21349324-21349346 TAGAATAAACAGATGTTAATAGG + Intergenic
1065278383 10:24109526-24109548 AAAAATGAACAGATGGAAACTGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067518879 10:46979634-46979656 CACAAAAAAGAGATGGAATTTGG + Intronic
1067643368 10:48072200-48072222 CACAAAAAAGAGATGGAATTTGG - Intergenic
1068021871 10:51595323-51595345 AAAAATAAACAGATAAAAATAGG + Intronic
1068520189 10:58069060-58069082 GAAAATAAACAGTTGGAGATGGG - Intergenic
1068789510 10:61011802-61011824 TGCAATAAACAGATTGAAATTGG + Intergenic
1069229099 10:65984741-65984763 CAAAATAAACAGAAAAAAATGGG + Intronic
1069457739 10:68567085-68567107 CAGAGTAAAAAGATGGACGTTGG - Intronic
1071140239 10:82501179-82501201 GAGAAGGAACAGATGGGAATGGG + Intronic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071699363 10:87913666-87913688 CAGAATAAAAAGAGAGAAAAGGG - Intronic
1071743035 10:88383870-88383892 CAGCATTAACAGATGGGCATGGG + Intronic
1072297620 10:94026454-94026476 AAGAAGAAAAAGATGGAAAAAGG - Intronic
1073196603 10:101696155-101696177 CAGGATAAACAGACAGAAATTGG - Intergenic
1074412696 10:113242095-113242117 CAGAATAAAGGGTTGGAAATGGG + Intergenic
1074988268 10:118677308-118677330 AAGTATAAACAGATGAAAATAGG - Exonic
1076019359 10:127058364-127058386 GAAAATAAAAGGATGGAAATAGG - Intronic
1078000163 11:7487501-7487523 AAGAATAAATGAATGGAAATGGG - Intronic
1078618336 11:12885131-12885153 AAGATTAAACAGAAGGAAACAGG + Intronic
1080293832 11:30702253-30702275 CTGTATAAAAACATGGAAATTGG - Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1082014652 11:47475782-47475804 CAGAATAGCCAGATAGAAAATGG - Intronic
1082869644 11:57932153-57932175 CAGAAGCAACAGATGAAAAAAGG - Intergenic
1084056852 11:66639551-66639573 CACAATAATCAAATGGAAGTGGG - Exonic
1085482708 11:76836124-76836146 CAGATTAAAGACATGGAAAGCGG + Intergenic
1085550690 11:77368141-77368163 CAGTATAAATAGATGTAAATAGG + Intronic
1085821580 11:79799271-79799293 TAAAATAGACAGGTGGAAATGGG - Intergenic
1086306222 11:85483946-85483968 CAATATAAAAAGATGCAAATTGG + Intronic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1087533378 11:99412019-99412041 CAGAATAAAAATAAAGAAATGGG + Intronic
1087591604 11:100196120-100196142 CAGAGTAAAAAAATGAAAATGGG + Intronic
1087623211 11:100565966-100565988 CAGAATGAAGAGATAGAAAAAGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088286693 11:108197204-108197226 CAGAAAAAAAAAATTGAAATTGG - Intronic
1088679099 11:112223840-112223862 CAGAATATATAGCTGTAAATAGG + Intronic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1090521317 11:127482624-127482646 AAGAGTACACAGATGGAAAGAGG - Intergenic
1091190674 11:133693132-133693154 AGGAATAAACAGCTGGAAAATGG - Intergenic
1091288012 11:134419535-134419557 CAGAACTAACTCATGGAAATCGG - Intergenic
1092740495 12:11624065-11624087 CAGACTAAACAAAGGGAAAGGGG - Intergenic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1093622971 12:21313995-21314017 CAGAAAAAAAAGAAAGAAATTGG + Intronic
1093706430 12:22279614-22279636 CAGAATGCAGAGATGAAAATGGG - Intronic
1093741085 12:22690045-22690067 CAGAAGAAAAAGAATGAAATTGG + Exonic
1095442822 12:42254979-42255001 AGGAATCAAGAGATGGAAATGGG - Intronic
1095796610 12:46225902-46225924 CAGAATAAAAGGAAAGAAATGGG + Intronic
1096588987 12:52644709-52644731 CAGAATACACATCTGGAAAATGG + Exonic
1097111841 12:56665551-56665573 CCGATAAAACAGATGGACATTGG - Intronic
1097449891 12:59723930-59723952 AAGAATGAAAAGATGAAAATTGG - Intronic
1097831358 12:64227532-64227554 CAAAATCAACAAATGAAAATTGG - Intergenic
1098034480 12:66288132-66288154 GAGAAGAAACATTTGGAAATTGG - Intergenic
1098150484 12:67541385-67541407 CAGAATAAGCAGAAGGGTATTGG + Intergenic
1098428081 12:70389098-70389120 AAGAATAAAGAGAGGAAAATGGG - Intronic
1099100295 12:78431556-78431578 CAGAATGAACTGATGGAAATGGG - Intergenic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1100354165 12:93813555-93813577 CAGAAGAAACAAATGAAACTGGG - Intronic
1100416631 12:94384732-94384754 GAGAATAAAGAGAAGAAAATTGG - Intronic
1101155628 12:101924950-101924972 CAGAAGAAAAGGGTGGAAATGGG + Intronic
1101261731 12:103039144-103039166 CAGAATAAACACAAGGAAAGAGG - Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1101939733 12:109090957-109090979 CAGAATAAAGAGGCTGAAATTGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108080175 13:46727188-46727210 AAGAAAAACCAAATGGAAATTGG + Intronic
1108621460 13:52188586-52188608 CAGAACAAACAGATTAATATAGG - Intergenic
1109202563 13:59447117-59447139 CAGAAGAAAAAAATGCAAATAGG + Intergenic
1109433318 13:62265776-62265798 CAGTATAAAAAGATGAAAATGGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1109676617 13:65684477-65684499 CAAAATAACCTGATGGAATTTGG + Intergenic
1109708319 13:66129418-66129440 CAGTATAAACAGCTGGTCATTGG + Intergenic
1110089444 13:71426432-71426454 CCAAATAAACAGGTGGAAAGCGG + Intergenic
1110588465 13:77223642-77223664 CAGAATCATAAGATGGGAATAGG - Intronic
1111028274 13:82563242-82563264 GAGCATAAACACATGAAAATTGG + Intergenic
1111195563 13:84871021-84871043 CTAAATCAACAGATGGTAATGGG + Intergenic
1111307191 13:86430029-86430051 GAGACTAAAAAGATTGAAATTGG - Intergenic
1111467420 13:88633285-88633307 AAAAATAAACTCATGGAAATTGG - Intergenic
1112105318 13:96233608-96233630 CCGAAAACACAGAAGGAAATTGG + Intronic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112880951 13:104105823-104105845 CAGATTAAACAGATGAGGATTGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1115269802 14:31539227-31539249 CAACAGAAACAGCTGGAAATGGG - Intronic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116625610 14:47259084-47259106 CTAAACAAACAAATGGAAATTGG - Intronic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1118522333 14:66598544-66598566 CAAAATAAAGAGGTGGAAAGAGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121701937 14:95961348-95961370 GAAAAGAAAGAGATGGAAATTGG + Intergenic
1121925703 14:97925505-97925527 CAGAATGAACAGATGGGTAATGG - Intergenic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123552633 15:21397851-21397873 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1123588879 15:21835239-21835261 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1123770832 15:23526709-23526731 CAGAAAAAAAAAATGGAACTTGG - Intergenic
1124217626 15:27821173-27821195 CAAAACAAACAAATGGAAACTGG - Intronic
1124493126 15:30170488-30170510 CAAAGTAATGAGATGGAAATAGG + Intergenic
1124750408 15:32367837-32367859 CAAAGTAATGAGATGGAAATAGG - Intergenic
1125572044 15:40727777-40727799 GAGGATAAACAGATGGCATTAGG - Intronic
1126371454 15:47951456-47951478 CAGAAAGAACAAATAGAAATTGG + Intergenic
1126470823 15:49008579-49008601 CAGAATAAACCAATGTAATTTGG + Intronic
1126491583 15:49242967-49242989 CAAAATACAAAGATGGAAAGTGG + Intronic
1127149745 15:56061015-56061037 CAAAATGAACAGCTGTAAATAGG - Intergenic
1128194833 15:65743270-65743292 GAGAATAAAGAGATTGGAATTGG - Intronic
1128319748 15:66684901-66684923 GAAAATAAACAGACAGAAATAGG + Intronic
1128608975 15:69058765-69058787 CAGACTCAACAGAGGGAAAGAGG - Intronic
1128664914 15:69531020-69531042 CAGGGTAAACTGAGGGAAATGGG - Intergenic
1129100834 15:73261525-73261547 AATAATAAGCAGTTGGAAATTGG + Intronic
1129625976 15:77200067-77200089 GAGACTGAACAGGTGGAAATAGG - Intronic
1130975507 15:88770435-88770457 CAAAGTAAAAAGTTGGAAATAGG - Intergenic
1131742438 15:95408808-95408830 CAGAATATATTTATGGAAATTGG - Intergenic
1131971835 15:97901300-97901322 CTGCATAAAGAAATGGAAATGGG - Intergenic
1202960982 15_KI270727v1_random:125071-125093 CAGAAAAAGCAGATGGCACTGGG - Intergenic
1133449685 16:5893503-5893525 CAGATAAAACAGATGGACACAGG - Intergenic
1134775974 16:16853927-16853949 CATAATAAATAGAAGTAAATGGG + Intergenic
1135076699 16:19400267-19400289 CTAAATCAACAGATGGTAATGGG - Intergenic
1135751296 16:25060502-25060524 CAGAGTAAAAAGATGTAAGTGGG - Intergenic
1137392045 16:48089548-48089570 CTGTGTAAACAGCTGGAAATAGG + Intronic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138806961 16:60101171-60101193 AAGAATAAACAAATGAAGATTGG - Intergenic
1138854770 16:60676937-60676959 CAGAATATACTCATGGTAATAGG - Intergenic
1140153672 16:72400027-72400049 ATAAATAAATAGATGGAAATAGG - Intergenic
1140309035 16:73831424-73831446 CATAAGAAACAGATGGGAATGGG + Intergenic
1142241449 16:88948865-88948887 AAGCACAAACAGTTGGAAATCGG + Intronic
1142522279 17:513629-513651 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522286 17:513675-513697 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522302 17:513767-513789 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522309 17:513813-513835 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522316 17:513859-513881 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522328 17:513951-513973 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522340 17:514043-514065 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522354 17:514135-514157 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522361 17:514181-514203 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522369 17:514227-514249 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522379 17:514273-514295 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522389 17:514319-514341 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522397 17:514365-514387 CGGAATAACCTGCTGGAAATGGG - Exonic
1142522405 17:514411-514433 CAGAATAACCTGCTGGAAATGGG - Exonic
1142522412 17:514457-514479 CAGAATAACCTGCTGGAAATGGG - Exonic
1142522419 17:514503-514525 CAGAATAACCTGCTGGAAATGGG - Exonic
1142522428 17:514549-514571 CGGAATAACCTGCTGGAAATGGG - Exonic
1145828915 17:27899082-27899104 TAGAATGAACAGGTGGAAAGGGG - Intergenic
1146154983 17:30515775-30515797 CAGAATAAAGAAATGTAACTGGG - Intronic
1146292311 17:31617620-31617642 TAGAATAAATGGATGCAAATAGG + Intergenic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148340224 17:46869015-46869037 GAAAATAAACAGAGGGAAACTGG + Intronic
1148964073 17:51419880-51419902 AACAATAAATAAATGGAAATAGG - Intergenic
1150514355 17:65792282-65792304 CAAAATACACAGATCGTAATGGG + Intronic
1150977472 17:70104714-70104736 CAGAAAACAAAGATGTAAATAGG + Intronic
1151429243 17:74051440-74051462 CAGCACAAACAAATGGCAATGGG + Intergenic
1152420221 17:80188753-80188775 CAGAATTAAAAGCTGGAACTGGG + Intronic
1203164127 17_GL000205v2_random:78433-78455 CATAATACCCAGGTGGAAATGGG + Intergenic
1154276993 18:12970398-12970420 AAGAAAAAACAGATGGACAGGGG - Intronic
1154280043 18:12994541-12994563 AAGAATAAAAACATGGAAAAGGG + Intronic
1155034521 18:22014664-22014686 GAGAATAAAGAGAGGGAAAAAGG - Intergenic
1155272656 18:24155861-24155883 CAGCATAAACTGATGGAAACTGG - Exonic
1155802738 18:30129754-30129776 GTGAATAAACACATAGAAATTGG - Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156045188 18:32870059-32870081 AAGAATGAACAGAGGAAAATAGG + Intergenic
1156299598 18:35824613-35824635 CATAATAAGTAGATGGGAATGGG + Intergenic
1156414311 18:36871823-36871845 CAGCAGACACAGCTGGAAATGGG + Intronic
1157058368 18:44257005-44257027 CCAACTGAACAGATGGAAATAGG - Intergenic
1157442525 18:47721686-47721708 CAGAATAAAAGGAAGGAAAGAGG + Intergenic
1157889173 18:51398238-51398260 AAGATTACACAGATGGAAACTGG - Intergenic
1159564439 18:70032466-70032488 CAAAATAAAGGGATGGAAAAAGG + Intronic
1159616692 18:70588404-70588426 CAAAATCAACATATAGAAATTGG - Intergenic
1159648312 18:70945917-70945939 GAAAATAAAGAGATGGAAAAAGG + Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1160131737 18:76231431-76231453 CAGACTAATCAGAAGGAAATGGG - Intergenic
1163208630 19:15823186-15823208 AAGAATAAACAGATTGAAACTGG + Intergenic
1164190048 19:22906153-22906175 CAGAATAAAAATGTGGAAAATGG - Intergenic
1164194314 19:22941934-22941956 CAGAAAAGACTAATGGAAATAGG - Intergenic
1165247636 19:34506323-34506345 AAGAATAAACAGAAAGAAATCGG + Exonic
1166215623 19:41332701-41332723 CAAATGAAACAGATAGAAATAGG + Intronic
1167487951 19:49774167-49774189 CACAATAACCAGCTGGAAACGGG - Intronic
1167783877 19:51620303-51620325 CAGAAGAAACAGGAGGAAAAAGG + Intronic
1168102296 19:54147734-54147756 AAGGAAAAACAGCTGGAAATTGG - Intronic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
924974179 2:157834-157856 CAGAATCAGAACATGGAAATTGG - Intergenic
925883685 2:8375353-8375375 CAACATAAAAAGATAGAAATGGG - Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926864434 2:17342375-17342397 CAGAATAAGAACATGGAGATCGG + Intergenic
927757116 2:25717731-25717753 CAGAAGGAACACATGCAAATAGG + Intergenic
928077236 2:28276181-28276203 AAGAATAAAGAGATGGTAAAAGG + Intronic
929375691 2:41284077-41284099 TAGAATAAACTGAAGTAAATAGG + Intergenic
930062398 2:47301029-47301051 CATAAAAATCAGATGGAATTTGG + Intergenic
930093790 2:47551357-47551379 AAGAATAAAGTGATGGAAGTAGG - Intronic
930499714 2:52198134-52198156 CAGAATAAAGGCATGGAATTGGG + Intergenic
931121375 2:59223966-59223988 CAGAATTCACAGATGGTAAGTGG - Intergenic
931764847 2:65445915-65445937 CATAATAATCACATGGAAAGTGG + Intergenic
933013619 2:77094726-77094748 CAGAATCAAAAGAATGAAATTGG + Intronic
933104836 2:78311305-78311327 TAGAATAAAAAGGTGGAAAAAGG + Intergenic
933306633 2:80608503-80608525 TAGAATAAACACAGGGTAATTGG - Intronic
933392182 2:81685208-81685230 AGGAATAAAGAGATGGAAAGGGG + Intergenic
933419095 2:82024554-82024576 CTAAATCAACAGATGGTAATGGG + Intergenic
935845187 2:107158421-107158443 CAGTATGAAAAGATGGAATTGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938127402 2:128684555-128684577 CAGAATCAACACATAGAAAGGGG - Intergenic
939327513 2:140712663-140712685 CAGAATAAACTGATGCAAACTGG - Intronic
939443398 2:142277596-142277618 GAGAAGAAAGAGATGGAGATGGG - Intergenic
939820939 2:146956047-146956069 CAGAATACAAAGCTGGAAAAGGG + Intergenic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940579801 2:155564104-155564126 CAGAAGAAAGAGAGGGAAAAAGG + Intergenic
940818318 2:158321633-158321655 CAGAAGAAAGAGAGGGAAAGGGG - Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941478812 2:165980710-165980732 AAGAATAAACAGATTTAAAATGG + Intergenic
941515720 2:166473867-166473889 TAGAATAAACAGTTGGAAAAAGG + Exonic
942173942 2:173313231-173313253 CATAAGAAACAGAGAGAAATTGG + Intergenic
942292147 2:174483893-174483915 CAGAATAATCACTTAGAAATTGG - Intronic
942781932 2:179654074-179654096 CAGAATCAACGGATGGATTTAGG + Intronic
948452525 2:238085264-238085286 AAGAAGAACCAAATGGAAATTGG + Intronic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1170912560 20:20588597-20588619 CAGAATATACAAATGTAAACTGG + Intronic
1170983657 20:21238692-21238714 CAGAATAAACACCATGAAATTGG - Intronic
1171302101 20:24072102-24072124 CAAAATAAACAGATGAATCTTGG - Intergenic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172295861 20:33810902-33810924 CAGAATTGACAGGTTGAAATTGG + Intergenic
1173171052 20:40724193-40724215 TTGAACAAACAGATGGACATGGG - Intergenic
1173356997 20:42302817-42302839 CAGAGTAAACAAATGCAAATGGG + Intronic
1173787391 20:45804336-45804358 AAGGATGAACAGAAGGAAATAGG - Intronic
1174108642 20:48181951-48181973 AAAAAAAAACAGAAGGAAATTGG + Intergenic
1174666424 20:52262122-52262144 CAGAATTTACAGAGGGAAATTGG - Intergenic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1175245060 20:57577215-57577237 GAGAATAGACAGATGGATAGTGG + Intergenic
1176992259 21:15511477-15511499 TAGAAGAAACAGATGAAAAATGG - Intergenic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1179122596 21:38562325-38562347 CAGTATTAACAAAAGGAAATGGG - Intronic
1180782920 22:18530874-18530896 CCAAATAAACAGAAGGAAAGGGG - Intergenic
1181239818 22:21470236-21470258 CCAAATAAACAGAAGGAAAGGGG - Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182743952 22:32590780-32590802 CCAAATAAATAGATGAAAATAGG - Intronic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
949440813 3:4078231-4078253 CAAACTATGCAGATGGAAATGGG + Intronic
949952402 3:9240067-9240089 TAGAATAAACAGTGTGAAATAGG - Intronic
950581077 3:13862513-13862535 GAAAATATACAGATGGAAAAAGG + Intronic
950763387 3:15254993-15255015 CAGAATTAACAGTTTGAAAGAGG + Exonic
950971065 3:17188387-17188409 CAATATAAACACATGGAAAAAGG + Intronic
951044601 3:18024184-18024206 TACAATACACAGAAGGAAATGGG + Intronic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951767810 3:26219437-26219459 GATAATAAAAAGATGGAAAGAGG + Intergenic
952724191 3:36565428-36565450 CAGAATAAAATGAGGGAACTTGG - Intergenic
952783507 3:37128397-37128419 AAGAATAGGCATATGGAAATTGG - Intronic
952800419 3:37285433-37285455 CATAATCAACAGATGAAAACTGG - Intronic
952922260 3:38293728-38293750 CAGAATCAGAACATGGAAATTGG - Intronic
952974292 3:38681059-38681081 TACAATAAACTGATGGAAAAAGG + Intergenic
954904489 3:54048510-54048532 CAGCATAAATGGATGGAAACTGG + Intergenic
955041832 3:55324794-55324816 CAGAATAACCATATGAAGATAGG - Intergenic
957297933 3:78355643-78355665 GAGAATAAACAGCTGGATATTGG - Intergenic
957848005 3:85764015-85764037 TAAAATGAACAGAGGGAAATGGG + Intronic
958894124 3:99811302-99811324 CAGAATCATCAGAAGGAAAATGG - Intergenic
959319556 3:104853844-104853866 CAGAATAAAAATAAGCAAATTGG + Intergenic
960073272 3:113455632-113455654 CAGAATATGCAGATGAAAATGGG - Intronic
961224232 3:125224711-125224733 CAGACTAAAAAAGTGGAAATAGG - Intergenic
961744803 3:129057751-129057773 CAGAAAAATCAGATGGTAATTGG + Intergenic
962003800 3:131327850-131327872 CAAAATAAAAACAGGGAAATAGG - Intronic
962185537 3:133255278-133255300 CTGAAACAAAAGATGGAAATAGG + Intronic
963210678 3:142686294-142686316 CTGATTAAGCAGATGAAAATAGG - Exonic
963763072 3:149304978-149305000 GAAAATAAAGAGATGGAAAGAGG - Intergenic
963965326 3:151362354-151362376 CACAATAAACAGAGGGAAAGGGG - Intronic
964153612 3:153559017-153559039 CACAATAAAAAAATGGTAATGGG + Intergenic
964318425 3:155468528-155468550 GAAAATAAACGGATGGAAAAAGG + Intronic
964735144 3:159909669-159909691 TAAAATAAGTAGATGGAAATGGG + Intergenic
965123981 3:164600349-164600371 CATAATAAAAAGATTCAAATAGG + Intergenic
965140376 3:164825724-164825746 AAGAATAAAAAGATGATAATTGG + Intergenic
965297063 3:166961106-166961128 CAGACAAAAAAGATGGAATTTGG - Intergenic
966143254 3:176780978-176781000 CAGACAAAACAGAAGGAAATGGG + Intergenic
967432985 3:189409977-189409999 AAGAAAATACAGATAGAAATAGG - Intergenic
971004125 4:22355238-22355260 TAAAATAAAAAGATGGAAAAAGG + Intronic
971114192 4:23624693-23624715 CAAAATAAACATATGAAAATCGG + Intergenic
971232623 4:24812263-24812285 CAGAATCAACAAAGGGAACTGGG - Intronic
971705020 4:30030459-30030481 AAGAATCAACACAGGGAAATAGG + Intergenic
971766686 4:30841597-30841619 AAGCACAAATAGATGGAAATAGG + Intronic
972158297 4:36192407-36192429 AAGAACAAACAGAGGGAAAGAGG + Intronic
973084797 4:46044568-46044590 TACAAAAAACAGATGGAAATAGG + Intronic
973787780 4:54349629-54349651 CAGAATAAACAGTAGGAACATGG + Intergenic
975140646 4:70915152-70915174 CATAACAAACCGATAGAAATTGG - Intronic
975499484 4:75069125-75069147 CAGAAGAATAAGATGAAAATAGG + Intergenic
975526653 4:75358213-75358235 CAGAATAAGTAAATGGAAGTTGG - Intergenic
976348917 4:84038221-84038243 GAAAACAAACAGAAGGAAATGGG - Intergenic
977507454 4:97920474-97920496 CACAATTAACAAGTGGAAATTGG + Intronic
977577528 4:98690883-98690905 CAGCATGAACAGATGGCTATAGG - Intergenic
977800857 4:101229538-101229560 AAGAATAAATAGATCAAAATAGG - Intronic
979211354 4:118107852-118107874 CATAATAAACTGATAGTAATGGG + Intronic
979317928 4:119288410-119288432 CAGATAATACAGTTGGAAATAGG + Intronic
979365387 4:119816151-119816173 AAGAAGAAAAAGATGGGAATGGG - Intergenic
979801742 4:124918096-124918118 CAAACAAAACAGATAGAAATTGG - Intergenic
979947326 4:126849321-126849343 GAGAATAGCTAGATGGAAATGGG + Intergenic
980196811 4:129599986-129600008 CAGAATGAACAAAAGAAAATGGG - Intergenic
980559182 4:134450134-134450156 CAGATAAAGCAGCTGGAAATAGG - Intergenic
980743971 4:136991402-136991424 CAGAACCAAGAGATGGAAGTAGG - Intergenic
980773131 4:137404597-137404619 CACAATTAAGAGATGGAATTGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981860293 4:149347265-149347287 CAGAAGAAACAGATTGCAAGAGG + Intergenic
981895316 4:149791996-149792018 GAGACTAAACTGATGCAAATAGG + Intergenic
981916572 4:150040413-150040435 CAGTATATACAGATTGAAAAGGG + Intergenic
982938310 4:161514852-161514874 CAGAAGAAAAATATAGAAATTGG - Intronic
983405584 4:167325297-167325319 CAGTACAAACTGATGCAAATTGG - Intergenic
983661157 4:170131995-170132017 CTAAATCAACAGATGGTAATGGG - Intergenic
983860866 4:172705515-172705537 CAATATAAAAAGATGTAAATTGG - Intronic
984118478 4:175712056-175712078 TAGAACAAAAAGATGGAAATTGG + Intronic
984245316 4:177268488-177268510 CAGAATAGAGAGTTGGAAAGGGG - Intergenic
984429675 4:179632632-179632654 CAGAATACACAATGGGAAATAGG - Intergenic
985858565 5:2450573-2450595 CATAAGAAACATACGGAAATAGG - Intergenic
986054415 5:4121632-4121654 CAGCAATAACAGATGGAAGTTGG - Intergenic
986064958 5:4226540-4226562 ATGAAGAAAGAGATGGAAATAGG - Intergenic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
986634675 5:9809641-9809663 CAGAATGAACAGATGAAGACAGG + Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988136564 5:27179215-27179237 CATAATTAACAGCTGAAAATTGG + Intergenic
988149755 5:27362684-27362706 CACAATAAACAGAGAGAAAAGGG + Intergenic
989065061 5:37452062-37452084 CAAAATAAAGAGAATGAAATTGG - Intronic
989539532 5:42602814-42602836 CAATATAAACAGATGTACATTGG - Intronic
990769953 5:59232097-59232119 CAGAAGTACCAGATCGAAATAGG + Intronic
990889099 5:60629688-60629710 ACAAATAACCAGATGGAAATTGG - Intronic
991557881 5:67915808-67915830 CACATAAAACAGATGGAAAATGG - Intergenic
992881153 5:81111787-81111809 CGGATTAAACTGATGGATATAGG - Intronic
993080841 5:83298334-83298356 TAGGATAAACAGAGGGAAATGGG - Intronic
993184509 5:84600428-84600450 CTGAATGAAGAGCTGGAAATGGG + Intergenic
993814046 5:92518664-92518686 GAGAATAAACAGATGTAGAGGGG - Intergenic
994650392 5:102519889-102519911 CAAAACAAAAAGATAGAAATGGG + Intergenic
995150692 5:108841062-108841084 GGGAATAAAAAGCTGGAAATGGG + Intronic
996094401 5:119382831-119382853 CACAATTATCAGATGCAAATAGG - Intronic
997321868 5:132984252-132984274 AAGAATAAACAGATGGGGGTGGG - Intergenic
997419950 5:133758382-133758404 AAGAATAAACATAAGGAAAGTGG + Intergenic
998742789 5:145224146-145224168 AAGATGAAACAGATGAAAATAGG + Intergenic
998855152 5:146387543-146387565 AAGAGAAAACAGATGGAGATGGG - Intergenic
999393214 5:151209562-151209584 CAGAAGAAAAAGAAAGAAATTGG - Intronic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
999648942 5:153746766-153746788 AAAAATACACAGAAGGAAATGGG + Intronic
1000681858 5:164194937-164194959 CAGAATAAATAGGGGGAAACTGG - Intergenic
1000745876 5:165032507-165032529 CAGCAAAAACAAAAGGAAATTGG + Intergenic
1000803066 5:165752445-165752467 CAGACTAAATAGATAGAAGTAGG - Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001492869 5:172168116-172168138 CAGAATAAAGACAGGGAAATAGG - Intronic
1001973946 5:175981470-175981492 CAAAATCAACAGAGTGAAATAGG + Intronic
1002243486 5:177862309-177862331 CAAAATCAACAGAGTGAAATAGG - Intergenic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003149102 6:3533694-3533716 CAGAACAAACAGATGGAGACAGG + Intergenic
1004628900 6:17402995-17403017 CATAATGAGGAGATGGAAATGGG - Intronic
1005323696 6:24679585-24679607 CAGAATCAGAACATGGAAATTGG - Intronic
1005658955 6:27974298-27974320 CAAAATAAACACATGAAATTTGG - Intergenic
1006003912 6:30987722-30987744 CAGCAGAAACACAAGGAAATGGG + Intronic
1006251219 6:32787405-32787427 CAGATTAATCAGAGGTAAATAGG + Intergenic
1007018225 6:38490990-38491012 CAGAATAAAAAGATCCAAAAGGG + Intronic
1008151365 6:47956171-47956193 CAGAAGAAACAGAACCAAATTGG - Intronic
1008506491 6:52235977-52235999 CAGACTAAACAGGTCAAAATGGG + Intergenic
1008629099 6:53347439-53347461 CAGAATCTACAGATAGAAACAGG - Intronic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1009354858 6:62730444-62730466 CAACAGAAACATATGGAAATTGG - Intergenic
1009437902 6:63638480-63638502 CAGAAAAAACATATGTAAAAAGG - Intronic
1009817105 6:68750604-68750626 CAGAATAAACAGTTAGCAAATGG - Intronic
1009923662 6:70094399-70094421 CAAAATACACATATGGAAACAGG + Intronic
1010123160 6:72403219-72403241 CAGAAGAAAAAGATGGAAAGAGG - Intergenic
1010368782 6:75083443-75083465 CAAAATAAACTGATGGAACTTGG + Intergenic
1011173770 6:84537146-84537168 CAGGATAAACAAATGAATATTGG + Intergenic
1011322601 6:86113387-86113409 GAAAATAAAGAGATGGAAAAAGG - Intergenic
1011900044 6:92282451-92282473 CAAAATAAACACAAAGAAATTGG - Intergenic
1012213554 6:96554887-96554909 CTGAATAAACAAAACGAAATTGG - Exonic
1012948752 6:105495491-105495513 CAGAATAAACAGAATGTATTGGG - Intergenic
1013026996 6:106285103-106285125 GAGAATAGAGAGATGGAAATTGG - Intronic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1013784464 6:113764334-113764356 CAGCAACAACAGATGGAAATGGG + Intergenic
1013824160 6:114191376-114191398 AAGAAAAAACACATGAAAATAGG + Intronic
1014252225 6:119126967-119126989 GAGAAGAAACAGCTGGACATCGG - Intronic
1014290404 6:119551540-119551562 CAAAATAAACAGAGAGTAATGGG - Intergenic
1014383035 6:120767916-120767938 CAGAATAAACATTTCTAAATAGG - Intergenic
1014506084 6:122258799-122258821 CAGAATAATAGAATGGAAATAGG - Intergenic
1014544819 6:122721629-122721651 CAGAACACAAGGATGGAAATAGG + Intronic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1014954746 6:127600665-127600687 CAGAAGAAACAAAAGGGAATGGG - Intergenic
1015267750 6:131306094-131306116 TAGAATAACCAGTTGCAAATTGG + Intergenic
1016247741 6:142005911-142005933 TAGAATAAAAGCATGGAAATGGG + Intergenic
1016336971 6:143017491-143017513 AAAAATAAACATATGAAAATGGG - Intergenic
1016924341 6:149327773-149327795 AAAAATAAGCACATGGAAATGGG + Intronic
1016935392 6:149445870-149445892 GAGAATAAACAGAAGGAAACAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017029699 6:150210369-150210391 AGGAATAAACAGATGGAGTTTGG - Intronic
1017216543 6:151914129-151914151 CAGAAGAAAAAGAAGAAAATTGG - Intronic
1018319344 6:162590542-162590564 CAGAAGATTCAGATGGAAAGTGG - Intronic
1018520696 6:164647207-164647229 AAGAATATACAGAAAGAAATTGG + Intergenic
1020004309 7:4774224-4774246 GAGAATGAAGAGATGGGAATCGG - Intronic
1020377590 7:7505463-7505485 CAGAACAAAAAGATGCAGATGGG - Intronic
1020623081 7:10541920-10541942 CAGATTAAAGAGATGGGAAGGGG + Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1021102033 7:16595323-16595345 CAAAATAAACATCTGTAAATAGG + Intergenic
1021248527 7:18294773-18294795 AAGAGTAGACACATGGAAATAGG + Intronic
1021911970 7:25395169-25395191 CAGAATTGCCAGATGAAAATAGG + Intergenic
1023003037 7:35830839-35830861 AAGCAGAAACAGATGGAAAGAGG - Intronic
1023130663 7:36999576-36999598 CAGAATAAAGAAAGAGAAATAGG + Intronic
1024412944 7:49067736-49067758 AAGAAGAAAAAAATGGAAATTGG + Intergenic
1025738599 7:64176889-64176911 CAGTAAAAAGAGATGAAAATTGG + Intronic
1025888288 7:65620424-65620446 CAGAACAAGGAGGTGGAAATGGG + Intergenic
1026409900 7:70109421-70109443 CAGAATGAACAGATTGCATTTGG - Intronic
1028328408 7:89557543-89557565 CATATGAAACAGAAGGAAATGGG - Intergenic
1028896138 7:96044098-96044120 CAAAATAAGCAGTTGGGAATGGG + Intronic
1030960661 7:115917178-115917200 CAGAACTAAAATATGGAAATTGG + Intergenic
1031102886 7:117504313-117504335 CAGAATCAACAGAAGGGATTTGG - Exonic
1031499625 7:122497535-122497557 CTGAGTTAACAGATGGGAATGGG - Intronic
1031554845 7:123161560-123161582 CAGAATGGACAGAGGGAGATGGG + Intronic
1031854146 7:126901542-126901564 CAGAACAAGGAGGTGGAAATGGG - Intronic
1031914830 7:127553230-127553252 AAGATTAAAAAGATGGATATTGG - Intergenic
1032739980 7:134729398-134729420 CAGATTAAACAGGTAGACATCGG - Intergenic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1034684896 7:152961644-152961666 CAAAATAAAAAGATATAAATAGG + Intergenic
1034695596 7:153050355-153050377 CTGAAGAAACAGATATAAATTGG + Intergenic
1035487014 7:159233881-159233903 CAGAATAAAAAGAAGAAAGTTGG - Intergenic
1035786351 8:2264244-2264266 CAAAAGAAACAGATGTGAATTGG + Intergenic
1035806456 8:2457472-2457494 CAAAAGAAACAGATGTGAATTGG - Intergenic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037698984 8:21255215-21255237 CAGAATAAAGAAATAGAAAAAGG - Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1038161669 8:25045445-25045467 GAAAATCAACAAATGGAAATGGG + Intergenic
1038331903 8:26615652-26615674 AAGAAAACACAGATGGCAATTGG + Intronic
1040122729 8:43700695-43700717 CTAAATCAACAGATGGCAATGGG - Intergenic
1041492460 8:58449621-58449643 AAGCAGAAACAGATGGAAAAAGG + Exonic
1041540773 8:58982389-58982411 AAGAATGAAAAGATGGAGATAGG - Intronic
1041764994 8:61409947-61409969 CATAATAAAAAGATGGGAAAGGG - Intronic
1041793848 8:61725646-61725668 CAGAATAAACAGACTGAGATAGG - Intergenic
1041896998 8:62936762-62936784 CAGAATAAACATATGACATTAGG - Intronic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1042341387 8:67683806-67683828 AAGAATAGAAAGAAGGAAATTGG - Intronic
1042432243 8:68721259-68721281 AAGAATAAAATGATGGAATTGGG - Intronic
1043354510 8:79396463-79396485 GAGAATAAACCTATGGTAATAGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043477588 8:80620217-80620239 CATAATAAACAAATGGAATTTGG - Intergenic
1043773915 8:84240880-84240902 CAGAATAAAATAATGGCAATAGG + Intronic
1043849432 8:85199163-85199185 CAGAATAATGAGAGGGAAAATGG - Intronic
1045348357 8:101315426-101315448 TGGGATCAACAGATGGAAATAGG + Intergenic
1045997891 8:108384664-108384686 CAGAATAACCTCATGAAAATTGG - Intronic
1046615014 8:116466823-116466845 CAGAGTAAACAGAAACAAATTGG + Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1047040062 8:120983473-120983495 GAGAACAAACACCTGGAAATAGG - Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049856446 8:144864975-144864997 CAGAATTAACAGAAGGTAACAGG + Intergenic
1050435377 9:5603761-5603783 CAAAATAGACTGATGAAAATAGG + Intergenic
1050716993 9:8541206-8541228 GAGAATAACCAAATGGAACTAGG + Intronic
1050760064 9:9058153-9058175 CAGAATATAAAGAGGGAATTAGG + Intronic
1051018020 9:12504922-12504944 CAGAATAATCTGATTGAATTGGG + Intergenic
1051029196 9:12654165-12654187 AAGAATTAACACATGGGAATGGG - Intergenic
1051756103 9:20402573-20402595 CATAATAAAAACATGGAAAGAGG - Intronic
1052380779 9:27768478-27768500 CAGAATTTACAGATGGAAAGTGG - Intergenic
1052629615 9:31020529-31020551 CATAAGAAAGAGATAGAAATTGG + Intergenic
1053016112 9:34663239-34663261 CAGAAGAAATGGATGGGAATGGG + Intronic
1053399867 9:37809532-37809554 CAGAATAAAAAGAGGGACATAGG + Intronic
1053453909 9:38216015-38216037 CAAAATAAAATGTTGGAAATAGG + Intergenic
1055153159 9:73027668-73027690 CAGAAAAACCAAATGGAAGTAGG - Intronic
1055213751 9:73833294-73833316 CAGTACAAAGAGATGGAATTTGG + Intergenic
1055417173 9:76096214-76096236 CAGAAGTAATATATGGAAATAGG + Intronic
1055621460 9:78129594-78129616 CAGTATCATCAGGTGGAAATGGG + Intergenic
1055983909 9:82036247-82036269 CAGAAAAAACAGATGGCAGTGGG + Intergenic
1055984826 9:82047197-82047219 CAGTATAAAAAGATGTAAATTGG - Intergenic
1056065664 9:82931763-82931785 AAGAAAAAACAGGTGGACATGGG - Intergenic
1056892164 9:90504662-90504684 CAAAATACAGAGTTGGAAATAGG + Intergenic
1058785156 9:108379622-108379644 CAGGATAAACAGTTAGAAATAGG - Intergenic
1058826402 9:108779122-108779144 CATAGAGAACAGATGGAAATAGG + Intergenic
1058923987 9:109643730-109643752 CAGAAAACAGAGTTGGAAATTGG - Intronic
1059631921 9:116134238-116134260 AAGATTAAAAAGATGGAGATGGG + Intergenic
1059710948 9:116867198-116867220 CATAAGAAACAGATGAAAAGAGG + Intronic
1185818822 X:3182388-3182410 CCTAATAAAAAGATGGAATTTGG + Intergenic
1186429317 X:9490908-9490930 CAGAAGAAACAGCTGGCAAAAGG - Intronic
1187296206 X:18003308-18003330 AAGAATACACAGACGGAAAATGG - Intergenic
1188207439 X:27378112-27378134 CAGACAAAACACATGCAAATTGG + Intergenic
1189964021 X:46353350-46353372 AAGAATCAAGGGATGGAAATGGG - Intergenic
1190727937 X:53203506-53203528 TAGAGTAAAAAGATGGAAAAGGG - Intronic
1191093058 X:56644488-56644510 CAAGATGAACAGAAGGAAATTGG - Intergenic
1191219986 X:57977822-57977844 AAGAATAAACAGAGGGGAAGTGG - Intergenic
1192192615 X:69001074-69001096 CAGAGGAAACAGATGCAAAGTGG + Intergenic
1193374305 X:80740209-80740231 AAGAATAAACAAAAGTAAATGGG + Intronic
1194818883 X:98480828-98480850 CTGAGTAAGCAGATGGGAATTGG + Intergenic
1196591254 X:117487554-117487576 CAGAATAAACAGAATAAAAGAGG + Intergenic
1198038905 X:132829692-132829714 CAGAAGAGACATCTGGAAATGGG - Intronic
1198319240 X:135503438-135503460 CAGAAAAAAAAGATGTAAAGAGG - Intergenic
1200095595 X:153658702-153658724 CACCATAAACAGCTAGAAATTGG + Intergenic
1200306498 X:155030987-155031009 CAGAATAAAAAGTAGAAAATAGG - Intronic
1201261512 Y:12163175-12163197 CCTAATAAAAAGATGGAATTTGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201339847 Y:12922859-12922881 CAGAATACACAGACGGCAACAGG - Intergenic
1201691607 Y:16772656-16772678 TTGAATAAACAGAATGAAATAGG - Intergenic