ID: 926720072

View in Genome Browser
Species Human (GRCh38)
Location 2:15953377-15953399
Sequence GTCGAAGCACACAGACCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926720068_926720072 12 Left 926720068 2:15953342-15953364 CCTTTGACCAGGAGAGGTAACAG No data
Right 926720072 2:15953377-15953399 GTCGAAGCACACAGACCTATTGG No data
926720066_926720072 19 Left 926720066 2:15953335-15953357 CCTGAAACCTTTGACCAGGAGAG No data
Right 926720072 2:15953377-15953399 GTCGAAGCACACAGACCTATTGG No data
926720069_926720072 5 Left 926720069 2:15953349-15953371 CCAGGAGAGGTAACAGAGCCTTT No data
Right 926720072 2:15953377-15953399 GTCGAAGCACACAGACCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926720072 Original CRISPR GTCGAAGCACACAGACCTAT TGG Intergenic
No off target data available for this crispr