ID: 926722190

View in Genome Browser
Species Human (GRCh38)
Location 2:15969068-15969090
Sequence CAGGGTGGGGACTCAGTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926722190_926722194 -6 Left 926722190 2:15969068-15969090 CCTGCAACTGAGTCCCCACCCTG No data
Right 926722194 2:15969085-15969107 ACCCTGCCTCTTTCTAGCTTTGG No data
926722190_926722196 -5 Left 926722190 2:15969068-15969090 CCTGCAACTGAGTCCCCACCCTG No data
Right 926722196 2:15969086-15969108 CCCTGCCTCTTTCTAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926722190 Original CRISPR CAGGGTGGGGACTCAGTTGC AGG (reversed) Intergenic
No off target data available for this crispr