ID: 926722769

View in Genome Browser
Species Human (GRCh38)
Location 2:15973889-15973911
Sequence TAGGAACACCAAAAAGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926722769_926722777 1 Left 926722769 2:15973889-15973911 CCCACCCCTTTTTGGTGTTCCTA No data
Right 926722777 2:15973913-15973935 AACCTTCCAGATGTTGGGCGAGG No data
926722769_926722774 -5 Left 926722769 2:15973889-15973911 CCCACCCCTTTTTGGTGTTCCTA No data
Right 926722774 2:15973907-15973929 TCCTATAACCTTCCAGATGTTGG No data
926722769_926722776 -4 Left 926722769 2:15973889-15973911 CCCACCCCTTTTTGGTGTTCCTA No data
Right 926722776 2:15973908-15973930 CCTATAACCTTCCAGATGTTGGG No data
926722769_926722780 16 Left 926722769 2:15973889-15973911 CCCACCCCTTTTTGGTGTTCCTA No data
Right 926722780 2:15973928-15973950 GGGCGAGGCAATTTATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926722769 Original CRISPR TAGGAACACCAAAAAGGGGT GGG (reversed) Intergenic
No off target data available for this crispr