ID: 926724421

View in Genome Browser
Species Human (GRCh38)
Location 2:15986460-15986482
Sequence TTCCCAGGGCTGGCCCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926724421_926724428 -3 Left 926724421 2:15986460-15986482 CCTGTCAGGGCCAGCCCTGGGAA No data
Right 926724428 2:15986480-15986502 GAATCATGGCACAGTTTGGGAGG No data
926724421_926724426 -7 Left 926724421 2:15986460-15986482 CCTGTCAGGGCCAGCCCTGGGAA No data
Right 926724426 2:15986476-15986498 CTGGGAATCATGGCACAGTTTGG No data
926724421_926724429 -2 Left 926724421 2:15986460-15986482 CCTGTCAGGGCCAGCCCTGGGAA No data
Right 926724429 2:15986481-15986503 AATCATGGCACAGTTTGGGAGGG No data
926724421_926724430 14 Left 926724421 2:15986460-15986482 CCTGTCAGGGCCAGCCCTGGGAA No data
Right 926724430 2:15986497-15986519 GGGAGGGCCTAGCCTTGCCAAGG No data
926724421_926724427 -6 Left 926724421 2:15986460-15986482 CCTGTCAGGGCCAGCCCTGGGAA No data
Right 926724427 2:15986477-15986499 TGGGAATCATGGCACAGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926724421 Original CRISPR TTCCCAGGGCTGGCCCTGAC AGG (reversed) Intergenic
No off target data available for this crispr