ID: 926725054

View in Genome Browser
Species Human (GRCh38)
Location 2:15991206-15991228
Sequence AAGAAGAAGAAGAAGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926725054_926725057 3 Left 926725054 2:15991206-15991228 CCGGCCACCTTCTTCTTCTTCTT No data
Right 926725057 2:15991232-15991254 TTTAAAGCCCAATTTCTAGTTGG No data
926725054_926725060 24 Left 926725054 2:15991206-15991228 CCGGCCACCTTCTTCTTCTTCTT No data
Right 926725060 2:15991253-15991275 GGAAAACCTGAGACTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926725054 Original CRISPR AAGAAGAAGAAGAAGGTGGC CGG (reversed) Intergenic
No off target data available for this crispr