ID: 926725850

View in Genome Browser
Species Human (GRCh38)
Location 2:15997305-15997327
Sequence CAGGGCCACCAGCATCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 0, 3: 36, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926725850_926725858 8 Left 926725850 2:15997305-15997327 CCTTCCTGATGCTGGTGGCCCTG 0: 1
1: 1
2: 0
3: 36
4: 360
Right 926725858 2:15997336-15997358 TCAGCCCTCTTGAAGTCAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 114
926725850_926725861 19 Left 926725850 2:15997305-15997327 CCTTCCTGATGCTGGTGGCCCTG 0: 1
1: 1
2: 0
3: 36
4: 360
Right 926725861 2:15997347-15997369 GAAGTCAGCTGGATCTCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 191
926725850_926725862 30 Left 926725850 2:15997305-15997327 CCTTCCTGATGCTGGTGGCCCTG 0: 1
1: 1
2: 0
3: 36
4: 360
Right 926725862 2:15997358-15997380 GATCTCTGAAGGCACTGACTTGG 0: 1
1: 0
2: 0
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926725850 Original CRISPR CAGGGCCACCAGCATCAGGA AGG (reversed) Intergenic
900568858 1:3348583-3348605 CATGGCCTCCAGCAGAAGGAGGG + Intronic
900589111 1:3451933-3451955 CAAGGCCCCCAGCATGAGGCTGG + Intergenic
902203402 1:14850784-14850806 CAGGGCCACCTTCCTCAGGCAGG - Intronic
902244622 1:15112472-15112494 CAGGGCCTCCAGCGTCACGCGGG + Exonic
902923893 1:19683138-19683160 CAGGGCTGGCAGCAGCAGGAAGG + Exonic
903543238 1:24108412-24108434 CAGGGCCCCCAGTCTGAGGAGGG - Intronic
903834070 1:26191351-26191373 CAGGGCCAGCAGCAGTTGGAAGG - Exonic
904732689 1:32606831-32606853 CAGGACTACCAGCTGCAGGAAGG - Intronic
905311563 1:37052493-37052515 CATTGCCACTAGCAACAGGATGG - Intergenic
905812424 1:40922537-40922559 GAGGTCCACCAGCCTCAGGGTGG - Intergenic
906306842 1:44724946-44724968 CCTGGCCACCAGCTGCAGGAGGG + Intronic
906613497 1:47219692-47219714 CTGGGCCACCAGGATCAGCCAGG - Exonic
907020221 1:51059749-51059771 CAGGACTACCAGCTGCAGGAAGG + Intergenic
907273578 1:53304725-53304747 CAGGGCCAGCAGTATGGGGATGG + Intronic
907985358 1:59524591-59524613 CAGGACTACCAGCTGCAGGAAGG + Intronic
909348793 1:74624321-74624343 TAGGGCCACCAGCATCAACATGG - Intronic
911632570 1:100199742-100199764 GAGGGCCAGCAGAAGCAGGATGG + Intronic
912549939 1:110479055-110479077 CAGGGCCATCAGCATGGGGCAGG + Intergenic
913077122 1:115350059-115350081 CAGAGCCATCAGCAGCTGGAGGG - Intergenic
916496988 1:165355678-165355700 CAGGGCGACCAGAATCAGCCAGG + Intronic
916542172 1:165767628-165767650 CAAGGCCATCAGCATCATGAAGG + Intronic
916558383 1:165911940-165911962 CTGGGTCACCAGCCTAAGGAAGG - Intergenic
917450632 1:175144713-175144735 CAGGGCCATGGCCATCAGGAAGG - Intronic
917817561 1:178725689-178725711 CAGCGCCCCCGGCTTCAGGACGG - Intronic
919264033 1:195237993-195238015 CAGGACTACCAGCTGCAGGAAGG + Intergenic
919756423 1:201068972-201068994 CAGGCCCACAAGTATCTGGATGG - Intronic
919768758 1:201143877-201143899 AGGGTCCACCAGCATCAGGAAGG + Exonic
919798163 1:201333786-201333808 CAGGGCCACCTGGATGGGGAAGG + Intergenic
921674662 1:217964872-217964894 CAGGACTACCAGCTGCAGGAAGG - Intergenic
922481945 1:225945244-225945266 GAGGTCCCCCAACATCAGGAAGG - Intergenic
922721538 1:227902545-227902567 CTGGGCCCCCAGCCTCTGGACGG - Intergenic
923603915 1:235426188-235426210 CAGGTGCAGCACCATCAGGAAGG - Intronic
924908954 1:248488588-248488610 CATGGCCAACATCACCAGGATGG + Exonic
924915152 1:248559470-248559492 CATGGCCAACATCACCAGGATGG - Exonic
1063027351 10:2193533-2193555 GAGGCCCACCTGCATCAGGGAGG + Intergenic
1064092310 10:12395525-12395547 AAGGGCCACCAGGATCAGGCTGG + Intronic
1066046144 10:31597193-31597215 CAGGGCCACCCACATTAGGGAGG + Intergenic
1067213764 10:44283179-44283201 GAGGGCCAGCAGCATGGGGAGGG - Intergenic
1067288836 10:44926975-44926997 CAGCGCCACGAGCAGCAGGGAGG + Intronic
1067944735 10:50682673-50682695 CAGGGCCACGAGGTCCAGGAGGG - Intergenic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1069725012 10:70571838-70571860 CAGTGCCACCAGCTCCTGGAAGG - Intergenic
1069818057 10:71211162-71211184 CTGGGCACCCAGCATCAGGAGGG - Intergenic
1070866237 10:79709544-79709566 CAGGGCCACGAGGTCCAGGAGGG - Intronic
1070880031 10:79847675-79847697 CAGGGCCACGAGGTCCAGGAGGG - Intronic
1070961461 10:80502888-80502910 GAGGCCCACCAGCATCTAGAGGG + Intronic
1071633143 10:87231765-87231787 CAGGGCCACGAGGTCCAGGAGGG - Intronic
1071646592 10:87363983-87364005 CAGGGCCACGAGGTCCAGGAGGG - Intronic
1071720052 10:88134469-88134491 CATGGCCACCACCATCATTATGG + Intergenic
1072207803 10:93220570-93220592 CAGGGTCCCCACCAGCAGGAAGG + Intergenic
1074106013 10:110390179-110390201 CAGGTCCCCCAGCAGCAGGAGGG - Intergenic
1075686024 10:124365711-124365733 CAGGGCCCCCGGCCTCAGCACGG + Intergenic
1075873605 10:125788894-125788916 CCTGGCCACTGGCATCAGGAAGG - Exonic
1076110750 10:127857254-127857276 CTGGCCCACCAGCATCTGCAAGG - Intergenic
1076338852 10:129728831-129728853 CAGCGTCACCAGCATCACAAAGG + Intronic
1076704920 10:132296049-132296071 CAGGGCCAGCATCGGCAGGAAGG + Intronic
1076885240 10:133259116-133259138 CAGGGCCACAAACCTCAGGAGGG - Intergenic
1076904935 10:133356964-133356986 CAGGGGCAGCAGCTTCAGCACGG + Exonic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077018690 11:407902-407924 CAGGGCCAGCAGGACCAGGAGGG + Exonic
1077042966 11:532668-532690 CGGGGCCACTCTCATCAGGAGGG + Exonic
1077161388 11:1114162-1114184 CAGAGCCACCTGCAGCTGGAAGG - Intergenic
1077187102 11:1240278-1240300 CAACGGCACCATCATCAGGAAGG + Exonic
1077225791 11:1438620-1438642 CAGAGCCACCAGCCTGAGGCTGG + Intronic
1077614315 11:3664228-3664250 CATGGCCAACATCCTCAGGATGG - Exonic
1078639011 11:13078074-13078096 CAGGGTCTCCAGCATCACGGAGG + Intergenic
1078927371 11:15886826-15886848 CAGAGCCACCTGCATCAGGCTGG + Intergenic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1082831839 11:57624118-57624140 CAGGACCACCAGGGTGAGGATGG + Intergenic
1083234644 11:61343764-61343786 CCAGGCCACCAGGGTCAGGATGG + Intronic
1083236865 11:61356666-61356688 CAGGGACCCCAGCAGCAGGCAGG + Exonic
1083277715 11:61606593-61606615 CAGGCACTCCAGCATCAGGATGG + Intergenic
1085117437 11:73942262-73942284 CAAGGCCTGCAGCATTAGGATGG + Intergenic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1085394935 11:76202467-76202489 CATGGGCACCAGCATGAGGTGGG - Intronic
1085477092 11:76795627-76795649 CACGGCCAGCAGCAGCAGCAGGG - Exonic
1089899418 11:121965343-121965365 CAGGCCAACCTGCATCTGGAAGG + Intergenic
1090167873 11:124570538-124570560 CACAGCCACCAGCAGCAGGCAGG - Exonic
1091871203 12:3892649-3892671 CTGGGCCACCTGCTTCAGGGAGG - Intergenic
1092148737 12:6232659-6232681 GAAGCCCACCAGCATCATGAGGG - Exonic
1092168628 12:6359351-6359373 CACGGCCTCCAGCATCAAGTTGG - Intronic
1092669757 12:10849423-10849445 CAGGACCAGCAGCATCTTGAAGG + Exonic
1093819638 12:23597972-23597994 CAGGCCCAACAGTTTCAGGATGG + Intronic
1096476816 12:51913628-51913650 CAGGGCCACCAGGGCCAGCAAGG - Exonic
1096477641 12:51918065-51918087 CATGGCCCCCAGCCTCAGGCTGG + Intronic
1097132043 12:56818895-56818917 AAGGCCCACCAGCACCAGCAAGG - Intergenic
1097267317 12:57753836-57753858 CAGGGCTACAAGTATCAGGATGG - Intronic
1097360784 12:58656093-58656115 CAGGGCTATCAGCTGCAGGAAGG - Intronic
1098322241 12:69257864-69257886 CTGGGCCAGCAGGACCAGGAGGG + Exonic
1098646137 12:72903673-72903695 CTTGGCCACCAACATCAGGCAGG + Intergenic
1099389052 12:82055841-82055863 CTGGGTCACCAGGATAAGGAGGG + Intergenic
1101621606 12:106394278-106394300 CAGGGCAGGCAGCACCAGGAAGG + Intronic
1103025942 12:117574084-117574106 AAGGGCCAGCAGCCTCAGCATGG + Intronic
1103724037 12:122989157-122989179 GAGGGTCACCAGAGTCAGGAAGG - Intronic
1104165971 12:126230086-126230108 CAGGGCCAGCCGCTTCAGGGTGG - Intergenic
1104570984 12:129925910-129925932 CAGGGACACCAGCTACAGCATGG + Intergenic
1104727051 12:131084635-131084657 CGGGACCACCTGCATGAGGATGG - Exonic
1104954091 12:132455277-132455299 CAGGGCCACCAGGAACAGCCGGG + Intergenic
1104969986 12:132526860-132526882 CAGGGCCTCCCCCAGCAGGAGGG - Intronic
1107666558 13:42696839-42696861 CAGGGCAACCTGCATCAGTCAGG - Intergenic
1108572474 13:51765054-51765076 CAGGGGCACTTGCAACAGGAAGG + Exonic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1113100554 13:106713024-106713046 CAGGGCCTCCTCCAACAGGAGGG - Intergenic
1113519054 13:110925402-110925424 CAGTCCCACCAGCACCATGACGG + Intergenic
1113970733 13:114186257-114186279 CAGGACAACCAGCTTCAGGGAGG + Intergenic
1114655008 14:24310738-24310760 CAGCGCCGCCAGCAGCAGGAAGG - Exonic
1119332143 14:73802798-73802820 CAGGCCCAGCACCATCAGGAAGG + Intergenic
1122606533 14:102950356-102950378 CAGGGCCACCTGCCGCAGCAAGG + Intronic
1122816619 14:104317126-104317148 CAGGGGCCCCAGCTGCAGGATGG - Intergenic
1123815604 15:23975725-23975747 CAGGTGCACCTGCTTCAGGAAGG + Intergenic
1124421843 15:29529624-29529646 CAGTCCCTCCAGCATCAGCAAGG + Intronic
1125472768 15:40020824-40020846 AAGTGAAACCAGCATCAGGAGGG - Intronic
1125722475 15:41851881-41851903 CAGGACCAGCACCCTCAGGAAGG + Intronic
1127384025 15:58452898-58452920 CAAGGCCACCAGCAGCAGATGGG - Intronic
1129229566 15:74189251-74189273 CACGCCCACCAGCAGCAGCAGGG + Exonic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1130932401 15:88438930-88438952 CAGGGCTCCCAGCAGCTGGAAGG - Intergenic
1131265234 15:90911627-90911649 CAGGGCCACAAGCAGGAGGGTGG - Intronic
1132503968 16:297609-297631 CAGGACCGCCAGCAACAGGCAGG - Intronic
1132551970 16:557236-557258 CAAGGCCAGCAGCCTCAGGCTGG + Intergenic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132572767 16:651253-651275 CAGACCCACCTGCCTCAGGAGGG - Exonic
1132715543 16:1288356-1288378 CGGGGCCTCCAGCTTCAGCAGGG + Intergenic
1132768125 16:1545296-1545318 GAGGGCCAGCAGCACCAAGAGGG + Intronic
1132827049 16:1910311-1910333 CATGGCCCCCAGCATCACTAGGG + Intergenic
1132859750 16:2064351-2064373 CAGGTCCACCAGCAACTGGGTGG - Exonic
1132929959 16:2454069-2454091 CAGGGCCAGCAGCACAGGGAGGG - Intronic
1133113778 16:3564649-3564671 CAGGCCCTCCACCAGCAGGAGGG + Exonic
1133229768 16:4360938-4360960 CAGGGCCACCAAGACCAGGTAGG - Exonic
1133287192 16:4696051-4696073 CAGGGCCACCAGGATCAGGAAGG - Intergenic
1133583350 16:7167486-7167508 CAGGACCACCAGAAACTGGAAGG + Intronic
1134202933 16:12213904-12213926 CAAGGCCACCAGAAGCAGCAGGG - Intronic
1135114070 16:19711176-19711198 AAGGGCCCCCAGCATGAGGATGG + Intronic
1135548384 16:23380530-23380552 CAAGGCCACCAGCTTGATGATGG - Exonic
1136187932 16:28599098-28599120 CTAGGCCACCAGTATCTGGAGGG + Intergenic
1136190404 16:28612092-28612114 CTAGGCCACCAGTATCTGGAGGG + Intronic
1138264531 16:55651058-55651080 CAGGGACACCACCATGAGGTGGG + Intergenic
1138301661 16:55935378-55935400 GAGGGCCACCCACATTAGGAAGG + Intronic
1141159427 16:81619203-81619225 AAGCTCCACCAGCATCAGGGTGG + Intronic
1141785692 16:86198966-86198988 CAGGGCCACCGGCTTCATGGTGG + Intergenic
1142307855 16:89295541-89295563 CAGCAGCACCAGCACCAGGAAGG - Intronic
1142619170 17:1154169-1154191 CAGGGACACCAGGATCATGAAGG - Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143491001 17:7285158-7285180 CAGAGCCACAGTCATCAGGATGG - Exonic
1143619503 17:8072997-8073019 CAGGGCCACCGGCAGGAGGAGGG - Intronic
1144119514 17:12137079-12137101 CAGGGCCACCAGTATCAAACAGG - Intronic
1144298211 17:13899399-13899421 CAGTGCCCCCAGGATCAGCAAGG - Intergenic
1144625273 17:16841177-16841199 CAGGGCCACCGGCAGAGGGATGG - Intergenic
1144764439 17:17725022-17725044 CAGGGTCAGCAGCCCCAGGAGGG - Intronic
1144881156 17:18431544-18431566 CAGGGCCACCGGCAGAGGGATGG + Intergenic
1145151076 17:20512842-20512864 CAGGGCCACCGGCAGAGGGATGG - Intergenic
1145273279 17:21415815-21415837 CTGGGCCACCACCATGAAGACGG - Exonic
1145311468 17:21703259-21703281 CTGGGCCACCACCATGAAGACGG - Exonic
1146162430 17:30567098-30567120 CAGGGCCACCGGCAGAGGGATGG - Intergenic
1147374523 17:40015913-40015935 CAGGGCCAACATCCTCTGGAAGG + Intronic
1147579428 17:41619876-41619898 CAGGGCCACCGGCAGAGGGATGG - Intronic
1147647115 17:42040509-42040531 CAGGGCATCCAGCAGCAGGTGGG + Intronic
1148458089 17:47821595-47821617 CAGACCCACCAGCTTCAGGTGGG + Intronic
1148795669 17:50195569-50195591 CAGGGCCAGCAGCACCAGCAGGG + Exonic
1148818288 17:50346208-50346230 CAGGCCCTGCAGCAGCAGGATGG - Exonic
1149992307 17:61389979-61390001 CAGGGCCACCAGGATGGGGAAGG - Intronic
1151405364 17:73882570-73882592 CAGAGCCTCCAGCCTCAGCAGGG - Intergenic
1151553648 17:74835933-74835955 CAGGGCCAGCACAATCATGACGG - Exonic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151656011 17:75496333-75496355 CTACGCCACCAGCATCAGCATGG + Exonic
1151675747 17:75596527-75596549 CTGGGCCAGCAGCATCTGGCTGG - Intergenic
1152079034 17:78175137-78175159 CAGCGGCACCAGGTTCAGGATGG + Exonic
1152522088 17:80862572-80862594 GAGGACCACCAGCAACACGAGGG - Intronic
1152560735 17:81077668-81077690 CAGCACCACCAGCCTCAGGACGG - Intronic
1152587365 17:81195060-81195082 CAGGTCCACCAGCACAAGGCCGG + Intronic
1152676747 17:81645218-81645240 CAGGGCCAGCAGCCCCAGCAGGG - Exonic
1152676807 17:81645431-81645453 CACGGCCTCAAGCACCAGGAAGG - Exonic
1152729867 17:81964331-81964353 CCAGGCCACCTGCATCAAGATGG + Intergenic
1152943307 17:83184093-83184115 CCAGGTCACCCGCATCAGGAAGG - Intergenic
1153291035 18:3501649-3501671 CAGGGCCACCAGCATTTCAAGGG + Intronic
1153323122 18:3792793-3792815 CAGGACCAACAGGATCTGGAAGG - Intronic
1153757890 18:8302063-8302085 CAGGACCATCAGCTTCAGGAGGG - Intronic
1154093010 18:11382166-11382188 CAGGGTCACAAGTCTCAGGATGG + Intergenic
1155215775 18:23641833-23641855 CAGGACTACCAGCTACAGGAAGG + Intronic
1155819208 18:30353119-30353141 CAGGACTACCAGCTGCAGGAAGG + Intergenic
1156985232 18:43342949-43342971 CAAGGCCACCAAGATCATGAAGG + Intergenic
1157833800 18:50880050-50880072 GATAGCCACAAGCATCAGGAAGG - Intronic
1158636220 18:59160734-59160756 AAGGACCAACAGCATCAGGGAGG - Intergenic
1160077581 18:75693092-75693114 CATGGCCTCCCGCATCATGAAGG + Intergenic
1160322390 18:77908192-77908214 CAGGGACACCAGTGTCATGAGGG + Intergenic
1160367303 18:78337417-78337439 CAGGGCCACAAGCACCATGCCGG + Intergenic
1161291581 19:3496584-3496606 CACGTCCACCAGCATGGGGATGG + Exonic
1161341573 19:3745974-3745996 GAGGACCAGCAGCTTCAGGAGGG - Intronic
1161755670 19:6131666-6131688 CCGGGCCACCAACATCTGTATGG - Intronic
1161849496 19:6731226-6731248 CACAGCCACCTGCAGCAGGATGG + Exonic
1161988933 19:7673012-7673034 CATGGCCACCAGCATCAGACAGG - Intergenic
1164299864 19:23952350-23952372 CAGGTCCTTCATCATCAGGAGGG + Intergenic
1164412175 19:28015116-28015138 GAGGGCCTCCAGCACCAGCAGGG + Intergenic
1164739256 19:30564515-30564537 CAGGACCACCAGCAGTGGGATGG - Intronic
1164794605 19:31015649-31015671 CAGGGCCAACAGGACCAGAAAGG + Intergenic
1166295825 19:41888822-41888844 CAGGGCCACGTGCTGCAGGAGGG - Exonic
1166837850 19:45678099-45678121 CAGGGGCACCAGCGTCAGCGTGG - Exonic
1167334871 19:48878662-48878684 CACACCCACCAGCATCATGACGG - Intergenic
1167585551 19:50373106-50373128 CACACCCACCAGCACCAGGACGG - Intronic
1167752052 19:51387375-51387397 CATGGCCACCACCAGGAGGATGG + Exonic
1168099988 19:54136250-54136272 CAGCACCACCCGCATCAGAATGG - Intergenic
925100434 2:1239686-1239708 CACAGCCACCAACACCAGGATGG - Intronic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
926181925 2:10652278-10652300 CATGGGCACCAGAAACAGGAAGG + Intronic
926227580 2:10979210-10979232 CACTGCCACCTGCATCACGAGGG + Intergenic
926725850 2:15997305-15997327 CAGGGCCACCAGCATCAGGAAGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
935657672 2:105438740-105438762 GAAGGCCACCAGCACCAGAAAGG + Intergenic
937315057 2:120926870-120926892 CGGTGCCGCCAGCCTCAGGAAGG - Intronic
938733301 2:134163248-134163270 AAGGCCCTCCAGAATCAGGAAGG - Intronic
938859273 2:135349993-135350015 CAGGAACACCAGCTTTAGGAAGG - Exonic
942259498 2:174144266-174144288 CAGTGCCACCAGCATATGTAAGG - Intronic
943928472 2:193819486-193819508 CAGGACTACCAGTAGCAGGATGG - Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
944709039 2:202319329-202319351 CAGGGTCACCAGCAGCACCATGG + Intergenic
945333684 2:208567244-208567266 CAGGGCCAGCAGACTCAGGTGGG - Intronic
946107837 2:217387718-217387740 CAAGGCCACCTGGAGCAGGATGG + Intronic
946148726 2:217749762-217749784 GAGGGCCCCCAGCATAATGAAGG - Intronic
947652673 2:231800332-231800354 AAAGGCCACCATCATCAAGAGGG - Intronic
948434558 2:237944271-237944293 CAGGACTACCAGCTGCAGGAAGG + Intergenic
948672508 2:239577581-239577603 CAGCTCCACCAGCATCATGGAGG + Intergenic
948941546 2:241199491-241199513 CAGTGCCGACAGCCTCAGGAGGG + Intronic
949040993 2:241849975-241849997 CAGGGCCACCAGCATCCAGGCGG - Exonic
1168862109 20:1052862-1052884 CAGGGCTGTGAGCATCAGGAGGG + Intergenic
1168955709 20:1832823-1832845 CAGGGCCACCCGGAGCTGGAGGG + Intergenic
1169475594 20:5928485-5928507 GAGGGCCGCCAGCATGATGAAGG + Intergenic
1170327880 20:15176499-15176521 CAGGACTACCAGCTGCAGGAAGG + Intronic
1171037353 20:21726340-21726362 CAGAGTCACCACCAGCAGGAAGG - Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171225690 20:23440293-23440315 CAGGGCAATCAGCAGCAGCAGGG - Exonic
1173663570 20:44750555-44750577 CAGGACCACCAGGTTGAGGAAGG - Exonic
1173720616 20:45254499-45254521 CAGGGCAAGCAGCACCAGGAAGG + Exonic
1173727895 20:45309528-45309550 CAGGTCGACCAGCCACAGGAGGG - Intronic
1173779723 20:45745094-45745116 GAGGCCCACCTGCATCATGAAGG - Intergenic
1173852766 20:46229121-46229143 CCTGGGCACCAGCATCTGGAGGG - Intronic
1173853209 20:46232043-46232065 CCTGGACACCAGCATCAGGAGGG + Intronic
1174369452 20:50076776-50076798 CAGGGCCACCAGCAGCAATGAGG + Intergenic
1175232382 20:57482072-57482094 CAGGACCCCAAGCAACAGGAAGG + Intergenic
1175729692 20:61345979-61346001 GAGTGCCACCCGCATGAGGAAGG - Intronic
1175883456 20:62274031-62274053 GAGGGCCACCAGAGACAGGAGGG - Intronic
1176057013 20:63154396-63154418 CAGGGCCACCAAGAACAGGCAGG + Intergenic
1176145556 20:63563846-63563868 CGGGGCCACCAGCAGCAGGGCGG - Exonic
1179270982 21:39850798-39850820 CAGGGCCACCAGCTTCTCCAGGG + Intergenic
1179640737 21:42745811-42745833 CAGCCCCACCAGCAGCACGAGGG + Intronic
1180868551 22:19133456-19133478 CAGGGCCAGCAGCATAAGATGGG + Exonic
1181284124 22:21739840-21739862 TGGGGCCTCCAACATCAGGAGGG - Intergenic
1181306314 22:21919196-21919218 CACCCCCACCAGCAGCAGGAAGG - Intergenic
1181582777 22:23837231-23837253 CAGGGCCACCAGGCTGTGGATGG - Intronic
1182797795 22:33004016-33004038 CAGGGCCAGCACCATGTGGAAGG - Intronic
1183332845 22:37230513-37230535 CAGGGCTGCCTGCATCAGGGAGG - Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185369815 22:50455830-50455852 TAGGGCCACCGGCATCTTGAGGG - Intronic
1185389124 22:50549353-50549375 CAGGGCCACCAGCTTGAGCTGGG - Exonic
949783696 3:7717678-7717700 ATGGCCCACCAGCAACAGGAAGG + Intronic
950868989 3:16212801-16212823 CAGGGCCACTAGCAGGAGGTGGG + Intronic
952157728 3:30661357-30661379 GAGGGCAACCAACATTAGGAGGG - Intronic
954807569 3:53229397-53229419 CTGTGCCACCCGCAACAGGACGG - Exonic
955500620 3:59579129-59579151 CAAGGCCACCGGCATGAGCATGG + Intergenic
955981243 3:64529742-64529764 CAGGGGCATCAGCATCACCAGGG + Intronic
958931939 3:100216558-100216580 CAGGGTCACCCTCATTAGGACGG + Intergenic
961150672 3:124635094-124635116 CAGGGCCACCAACATCACCTAGG - Intronic
961219320 3:125187369-125187391 GAGGGCCACCAGGATGACGAAGG + Exonic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961445237 3:126977461-126977483 CAAGGCCACCAGGAGCAGAAGGG + Intergenic
961647487 3:128400314-128400336 CAAGGCCACCCCCATCAGCAGGG - Intronic
962318099 3:134371189-134371211 CAGGGCCAGGAGCACCAGGGCGG - Exonic
962840373 3:139227222-139227244 CAGGGCTACCAGGATCCAGATGG + Intronic
966223277 3:177571337-177571359 CAGAGCCACCACCAGCAAGAAGG - Intergenic
966460647 3:180172641-180172663 GAGGGACACCAGCATCATTAAGG - Intergenic
966937843 3:184725577-184725599 CAGGGGAAGCTGCATCAGGACGG - Intergenic
967152748 3:186664756-186664778 CAGAGCCAGCAGCATCAGAAGGG - Intronic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968471287 4:783516-783538 CCCAGCCAGCAGCATCAGGAAGG + Intergenic
968558791 4:1265367-1265389 CAGAACCACCAGCATCAGGGTGG + Intergenic
968911564 4:3479162-3479184 CGGGGCCACCAGCGGCTGGAAGG - Intronic
968913574 4:3487531-3487553 CAGACCCACCAGGAGCAGGAGGG + Intronic
969275131 4:6129587-6129609 AATGGCCATCAGCATCATGAGGG - Intronic
969526176 4:7705232-7705254 CAGGGCCCCCAGGAGCTGGAAGG + Intronic
970608293 4:17702832-17702854 CCCGGCCACAAGCAGCAGGAGGG - Intronic
971163028 4:24153837-24153859 CTGGGCCACCAGCCCCAGAAAGG + Intergenic
971336448 4:25727906-25727928 GAGGGCCCACAGAATCAGGAAGG - Intergenic
971339772 4:25757411-25757433 CATGACCAACAGCACCAGGAGGG + Intronic
971755472 4:30702323-30702345 GAGGGCCACCAACATTAGGGAGG - Intergenic
975682697 4:76892593-76892615 TAGGGCCACCAGCATCCCAATGG + Intergenic
976362981 4:84202471-84202493 GAGGGCCAGCAGAAGCAGGATGG + Intergenic
976416312 4:84780213-84780235 CATGGCCACCAGGCCCAGGATGG + Exonic
982314018 4:154012877-154012899 GAGGCCCACCAGCATTATGAAGG - Intergenic
982802578 4:159722925-159722947 CAGGACTACCAGCTGCAGGAAGG - Intergenic
983005199 4:162475934-162475956 TAGAGCCACCAGCAGCTGGAGGG + Intergenic
985478851 5:94624-94646 CAGGACCAACACCTTCAGGATGG - Intergenic
985558518 5:569885-569907 CAGGGCCACCAGGATCCACATGG + Intergenic
985620500 5:952436-952458 CAGGGGCACCAGGTTCAGGGAGG - Intergenic
985657609 5:1140250-1140272 CAGGGCCACCTTTCTCAGGAGGG - Intergenic
990499513 5:56381708-56381730 CAGGCAGCCCAGCATCAGGAAGG + Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
990872555 5:60448672-60448694 CAGGGAAGCCAGCATCAGAATGG + Intronic
991281329 5:64917595-64917617 GAGGGCCACCCACATTAGGAAGG - Intronic
991332824 5:65510940-65510962 CAGAGTCACCAGCAGCAAGAGGG + Intergenic
991399048 5:66234722-66234744 CAGAACCAGCAGCATCAGCATGG - Intergenic
991405130 5:66293964-66293986 CAGAACCAGCAGCATCAGCATGG + Intergenic
994729595 5:103476230-103476252 TAGGGACACAAGCATTAGGAAGG + Intergenic
994744266 5:103659232-103659254 CAGGGAGAGCAGCAACAGGAAGG + Intergenic
994941040 5:106324530-106324552 CTGGGCTACCAGCATCATGCTGG + Intergenic
995146167 5:108788548-108788570 CAGAGTCACAGGCATCAGGAGGG - Intronic
996112693 5:119584070-119584092 CAGGGCTACCACCACCATGAAGG - Intronic
997767540 5:136519963-136519985 CTTGGCCACCAGCAGCAGGTGGG + Intergenic
999098201 5:149000064-149000086 CAGGGTTACGGGCATCAGGAAGG - Intronic
999409172 5:151335422-151335444 GAGGACCAGCAGCACCAGGAAGG + Exonic
999493647 5:152075521-152075543 CTGGGCCTCTAGCATCAGCAAGG + Intergenic
1000789828 5:165592180-165592202 CAGGGCCATCTGCAAAAGGAAGG + Intergenic
1001034787 5:168290083-168290105 CAGGGACACCAGCCTCAGACTGG - Intergenic
1002520662 5:179791927-179791949 TGGAGGCACCAGCATCAGGAGGG - Intronic
1002521762 5:179796282-179796304 CAGCGCCACCAGCAGCCAGAGGG - Exonic
1002536016 5:179875963-179875985 CAGGGCCACCAGGAGCCAGAAGG + Exonic
1003674686 6:8192375-8192397 GAGGGGCACCAGCAACAGGAGGG + Intergenic
1003973115 6:11317913-11317935 AAGGCCCACCTGCATCGGGAGGG - Intronic
1004543460 6:16573759-16573781 CAGGGACAAAAGCATGAGGAAGG - Intronic
1004720798 6:18265976-18265998 CAGGCCTACCAGCTGCAGGAAGG - Intergenic
1006919871 6:37620283-37620305 CAGTTCCATCAGCATGAGGAAGG + Intergenic
1006946622 6:37788644-37788666 CATGGCCACCTGAAGCAGGATGG - Intergenic
1010831218 6:80532326-80532348 CATGGCCACTACCATGAGGAGGG + Intergenic
1011082360 6:83503555-83503577 GAGGCCCACCCACATCAGGAAGG + Intergenic
1013648746 6:112171997-112172019 CACAGCCGCCAGCATCAAGAGGG - Intronic
1018112460 6:160548577-160548599 CATGGACCCCAGCATCAGGTGGG - Exonic
1018823876 6:167394904-167394926 AAGGGGCACCTGCGTCAGGATGG + Intergenic
1019073938 6:169371608-169371630 CAGAGCGAGCAGCACCAGGAAGG + Intergenic
1019507366 7:1399056-1399078 CAGGGCCACCAGAGCCAGGCTGG + Intergenic
1019729379 7:2622097-2622119 CAGGGCCCCCACCTCCAGGATGG + Intergenic
1020853563 7:13388993-13389015 CAGGGGCACCATGATCAGGGTGG - Intergenic
1022467254 7:30660378-30660400 CAGGGCATCGAGCATGAGGAAGG + Intronic
1022825643 7:34009997-34010019 CACTGACACCAGCATAAGGAAGG - Intronic
1023499772 7:40835166-40835188 CAGAGCCACCAGCCTCATGTGGG - Intronic
1023610131 7:41964504-41964526 CAGGGCCCCCGACATCAGGCTGG + Exonic
1026370149 7:69691070-69691092 CAGGACTACCAGCTGCAGGAAGG - Intronic
1026699642 7:72628858-72628880 CACGGCCACCAGAGTCAGCAGGG + Intronic
1027422096 7:78026730-78026752 CAGGGCATCCAGCTTCAGGCTGG + Intronic
1027734903 7:81920337-81920359 CAGGACTACCAGCTTCAGGAAGG - Intergenic
1030138996 7:106285594-106285616 CAGGGTCAGGAGGATCAGGAGGG - Intronic
1030875674 7:114810404-114810426 CAGGGCCACCAGGATTATCAAGG - Intergenic
1032086507 7:128886704-128886726 CAGGGCCGGGAGCACCAGGATGG - Exonic
1032431041 7:131861785-131861807 CAGGGCTACTAGAAGCAGGAAGG - Intergenic
1032782012 7:135170934-135170956 CAGCGCCACCGGCTTGAGGAGGG + Intergenic
1033245431 7:139713393-139713415 TAGGGGCACCAGCACCAGGCAGG + Intronic
1033582918 7:142752864-142752886 CAGGGCCACCAGAATCACCCTGG - Exonic
1033585944 7:142774352-142774374 CAGGGCCACCAGAATCACCCTGG - Intergenic
1033598780 7:142874623-142874645 CATGGTCACCAGCACCATGAAGG + Exonic
1033604358 7:142915013-142915035 CATGGTCACCAGCACCAGGGAGG + Exonic
1034356150 7:150451882-150451904 CAGGGCAACCATCAAGAGGAAGG - Intronic
1034421822 7:150994718-150994740 CAGAGCCACCAGCGGCAGGGAGG - Intronic
1034817145 7:154182387-154182409 CATGGCAACCAGCATGAGGAGGG - Intronic
1034849565 7:154481065-154481087 CAAGCCCAGCAGCAGCAGGAAGG + Intronic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035253674 7:157613086-157613108 CAGCGCCCCCCGCATCCGGAGGG + Intronic
1036229564 8:6988227-6988249 CAGGGCCACCAGGAGAAGCATGG + Intergenic
1036232015 8:7007330-7007352 CAGGGCCACCAGGAGAAGCATGG + Intronic
1036626818 8:10479298-10479320 CAGGGCGACCCGCAGCAGGAGGG + Intergenic
1036907655 8:12720546-12720568 CAGGACTACCAGCTGCAGGAAGG + Intergenic
1037249597 8:16877139-16877161 CAGTGCCCCCAGCACCAGCAAGG + Intergenic
1038156536 8:24996687-24996709 CAGGAGCACCAGCATCAGACTGG - Intergenic
1039558396 8:38493450-38493472 CAGAGTTACCAGCATCAGCATGG + Intergenic
1043393690 8:79815915-79815937 CAGGTGCACCAGCATCACTAGGG + Intergenic
1044279143 8:90336558-90336580 CTGGGCCTCCAGAATAAGGAGGG - Intergenic
1044587680 8:93883238-93883260 CAGGCCTGGCAGCATCAGGAGGG - Intronic
1045315472 8:101040257-101040279 CAGAGCCACCAGAAGCTGGAAGG - Intergenic
1046044997 8:108954180-108954202 CAGGCCCACCAGAATCTTGAAGG - Intergenic
1047539063 8:125746448-125746470 CAGAGACACCAGCATCAGCCAGG + Intergenic
1048293875 8:133200273-133200295 CAAGGCCACCAGCTTCAGCATGG + Intronic
1048339093 8:133525309-133525331 CAGGACTACCAGCTGCAGGAAGG - Intronic
1049011939 8:139893037-139893059 CAGGGCCTGTAGCATCAGTAAGG - Intronic
1049265067 8:141663461-141663483 CAGAGCCACCAGCACCTAGAAGG - Intergenic
1049514298 8:143045297-143045319 CAGGGCCACCAGCAGGACCAGGG + Intronic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1051170646 9:14315577-14315599 CAGGGCCCGCAGCCTCTGGAGGG - Intronic
1052116028 9:24649252-24649274 CAGGACTACCAGCTACAGGAAGG + Intergenic
1052901688 9:33799024-33799046 CAGGGCCACCAGAGTCACGCTGG - Exonic
1053425415 9:38006887-38006909 CAGGGCCACCTTCAGTAGGAAGG - Intronic
1056921350 9:90792051-90792073 CAGGGCCAGCAGGGTCAGCAGGG + Intergenic
1057354227 9:94321466-94321488 CAGGGCCACGAGGTCCAGGAGGG + Intronic
1057628095 9:96695997-96696019 CATGGCCACCAGAATGTGGATGG + Intergenic
1057653537 9:96936169-96936191 CAGGGCCACGAGGTCCAGGAGGG - Intronic
1060067659 9:120517330-120517352 TAGGGACACCAGGATCCGGAAGG - Intronic
1060522923 9:124304096-124304118 CAGTCCCACCAGCATCTGGCTGG + Intronic
1060719398 9:125965205-125965227 AAGGGCCAGCAGCATGTGGAAGG + Intronic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1061574698 9:131498761-131498783 CAGAGCTGCCAGCGTCAGGAGGG - Exonic
1061591935 9:131603395-131603417 CTGGGGCAGCAGCATCACGAGGG + Intronic
1061837910 9:133341525-133341547 CAGGGCCACCAGCATGGGAGTGG + Exonic
1061860380 9:133464875-133464897 CAGTGGCACCAGCACCAGGAAGG - Intronic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1185659878 X:1719354-1719376 CAAGGCCACCAGCATGAAGGAGG - Intergenic
1186245443 X:7611616-7611638 AAGGGCTACCAGCATTAGGCAGG - Intergenic
1189096861 X:38149792-38149814 CAGGGCCACAGGCATCACCAGGG + Exonic
1189118759 X:38370936-38370958 CATGGCACCCAGCATGAGGAAGG - Intronic
1197148505 X:123194099-123194121 CAGGCCCACTACCATCAGAAGGG - Intronic
1199680459 X:150220905-150220927 CAGAGCCACCAGAAGCTGGAGGG - Intergenic
1200089759 X:153628914-153628936 AAAGGCCAGCAGCATCAGGCTGG + Intergenic