ID: 926726928

View in Genome Browser
Species Human (GRCh38)
Location 2:16005675-16005697
Sequence AAGAAAGAGGAGAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926726928_926726940 30 Left 926726928 2:16005675-16005697 CCACCCTCCTTCTCCTCTTTCTT No data
Right 926726940 2:16005728-16005750 CCAGGCAGATCACTAAGGTCAGG No data
926726928_926726935 12 Left 926726928 2:16005675-16005697 CCACCCTCCTTCTCCTCTTTCTT No data
Right 926726935 2:16005710-16005732 TTTTGAAAATCACTCCTCCCAGG No data
926726928_926726936 25 Left 926726928 2:16005675-16005697 CCACCCTCCTTCTCCTCTTTCTT No data
Right 926726936 2:16005723-16005745 TCCTCCCAGGCAGATCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926726928 Original CRISPR AAGAAAGAGGAGAAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr