ID: 926730188

View in Genome Browser
Species Human (GRCh38)
Location 2:16030666-16030688
Sequence GGGCAGCTGGGAAACTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730188_926730210 28 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730188_926730197 -1 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730197 2:16030688-16030710 CTGCGGACCCACCACCCAGAGGG No data
926730188_926730205 15 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730205 2:16030704-16030726 CAGAGGGTGAGCCTATGGGCAGG No data
926730188_926730209 27 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730209 2:16030716-16030738 CTATGGGCAGGATTGGGCCCCGG No data
926730188_926730206 20 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730206 2:16030709-16030731 GGTGAGCCTATGGGCAGGATTGG No data
926730188_926730196 -2 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730196 2:16030687-16030709 CCTGCGGACCCACCACCCAGAGG No data
926730188_926730207 21 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730188_926730201 10 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730201 2:16030699-16030721 CCACCCAGAGGGTGAGCCTATGG No data
926730188_926730202 11 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730188 Original CRISPR GGGCAGCTGGGAAACTGGGC TGG (reversed) Intergenic
No off target data available for this crispr