ID: 926730194

View in Genome Browser
Species Human (GRCh38)
Location 2:16030686-16030708
Sequence CTCTGGGTGGTGGGTCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730194_926730214 20 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730194_926730213 19 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730213 2:16030728-16030750 TTGGGCCCCGGGCATGAGGAGGG No data
926730194_926730205 -5 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730205 2:16030704-16030726 CAGAGGGTGAGCCTATGGGCAGG No data
926730194_926730206 0 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730206 2:16030709-16030731 GGTGAGCCTATGGGCAGGATTGG No data
926730194_926730201 -10 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730201 2:16030699-16030721 CCACCCAGAGGGTGAGCCTATGG No data
926730194_926730210 8 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730194_926730212 18 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730212 2:16030727-16030749 ATTGGGCCCCGGGCATGAGGAGG No data
926730194_926730207 1 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730194_926730202 -9 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data
926730194_926730209 7 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730209 2:16030716-16030738 CTATGGGCAGGATTGGGCCCCGG No data
926730194_926730211 15 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730211 2:16030724-16030746 AGGATTGGGCCCCGGGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730194 Original CRISPR CTCTGGGTGGTGGGTCCGCA GGG (reversed) Intergenic
No off target data available for this crispr