ID: 926730198

View in Genome Browser
Species Human (GRCh38)
Location 2:16030695-16030717
Sequence AGGCTCACCCTCTGGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730198_926730209 -2 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730209 2:16030716-16030738 CTATGGGCAGGATTGGGCCCCGG No data
926730198_926730211 6 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730211 2:16030724-16030746 AGGATTGGGCCCCGGGCATGAGG No data
926730198_926730219 24 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730219 2:16030742-16030764 TGAGGAGGGGTTACCTAAGCGGG No data
926730198_926730222 29 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730222 2:16030747-16030769 AGGGGTTACCTAAGCGGGGGCGG No data
926730198_926730213 10 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730213 2:16030728-16030750 TTGGGCCCCGGGCATGAGGAGGG No data
926730198_926730212 9 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730212 2:16030727-16030749 ATTGGGCCCCGGGCATGAGGAGG No data
926730198_926730206 -9 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730206 2:16030709-16030731 GGTGAGCCTATGGGCAGGATTGG No data
926730198_926730221 26 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730221 2:16030744-16030766 AGGAGGGGTTACCTAAGCGGGGG No data
926730198_926730207 -8 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730198_926730214 11 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730198_926730210 -1 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730198_926730220 25 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730220 2:16030743-16030765 GAGGAGGGGTTACCTAAGCGGGG No data
926730198_926730218 23 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730218 2:16030741-16030763 ATGAGGAGGGGTTACCTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730198 Original CRISPR AGGCTCACCCTCTGGGTGGT GGG (reversed) Intergenic