ID: 926730199

View in Genome Browser
Species Human (GRCh38)
Location 2:16030696-16030718
Sequence TAGGCTCACCCTCTGGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730199_926730210 -2 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730199_926730213 9 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730213 2:16030728-16030750 TTGGGCCCCGGGCATGAGGAGGG No data
926730199_926730206 -10 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730206 2:16030709-16030731 GGTGAGCCTATGGGCAGGATTGG No data
926730199_926730222 28 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730222 2:16030747-16030769 AGGGGTTACCTAAGCGGGGGCGG No data
926730199_926730207 -9 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730199_926730211 5 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730211 2:16030724-16030746 AGGATTGGGCCCCGGGCATGAGG No data
926730199_926730221 25 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730221 2:16030744-16030766 AGGAGGGGTTACCTAAGCGGGGG No data
926730199_926730218 22 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730218 2:16030741-16030763 ATGAGGAGGGGTTACCTAAGCGG No data
926730199_926730214 10 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730199_926730219 23 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730219 2:16030742-16030764 TGAGGAGGGGTTACCTAAGCGGG No data
926730199_926730209 -3 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730209 2:16030716-16030738 CTATGGGCAGGATTGGGCCCCGG No data
926730199_926730212 8 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730212 2:16030727-16030749 ATTGGGCCCCGGGCATGAGGAGG No data
926730199_926730220 24 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730220 2:16030743-16030765 GAGGAGGGGTTACCTAAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730199 Original CRISPR TAGGCTCACCCTCTGGGTGG TGG (reversed) Intergenic
No off target data available for this crispr