ID: 926730202

View in Genome Browser
Species Human (GRCh38)
Location 2:16030700-16030722
Sequence CACCCAGAGGGTGAGCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730189_926730202 7 Left 926730189 2:16030670-16030692 CCCAGTTTCCCAGCTGCCCTGCG No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data
926730190_926730202 6 Left 926730190 2:16030671-16030693 CCAGTTTCCCAGCTGCCCTGCGG No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data
926730194_926730202 -9 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data
926730188_926730202 11 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data
926730195_926730202 -10 Left 926730195 2:16030687-16030709 CCTGCGGACCCACCACCCAGAGG No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data
926730193_926730202 -2 Left 926730193 2:16030679-16030701 CCAGCTGCCCTGCGGACCCACCA No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data
926730187_926730202 14 Left 926730187 2:16030663-16030685 CCTCCAGCCCAGTTTCCCAGCTG No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data
926730192_926730202 -1 Left 926730192 2:16030678-16030700 CCCAGCTGCCCTGCGGACCCACC No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data
926730186_926730202 18 Left 926730186 2:16030659-16030681 CCTACCTCCAGCCCAGTTTCCCA No data
Right 926730202 2:16030700-16030722 CACCCAGAGGGTGAGCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730202 Original CRISPR CACCCAGAGGGTGAGCCTAT GGG Intergenic
No off target data available for this crispr