ID: 926730203

View in Genome Browser
Species Human (GRCh38)
Location 2:16030702-16030724
Sequence TGCCCATAGGCTCACCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730203_926730224 29 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730224 2:16030754-16030776 ACCTAAGCGGGGGCGGTGTTGGG No data
926730203_926730220 18 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730220 2:16030743-16030765 GAGGAGGGGTTACCTAAGCGGGG No data
926730203_926730209 -9 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730209 2:16030716-16030738 CTATGGGCAGGATTGGGCCCCGG No data
926730203_926730218 16 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730218 2:16030741-16030763 ATGAGGAGGGGTTACCTAAGCGG No data
926730203_926730221 19 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730221 2:16030744-16030766 AGGAGGGGTTACCTAAGCGGGGG No data
926730203_926730219 17 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730219 2:16030742-16030764 TGAGGAGGGGTTACCTAAGCGGG No data
926730203_926730210 -8 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730203_926730222 22 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730222 2:16030747-16030769 AGGGGTTACCTAAGCGGGGGCGG No data
926730203_926730213 3 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730213 2:16030728-16030750 TTGGGCCCCGGGCATGAGGAGGG No data
926730203_926730212 2 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730212 2:16030727-16030749 ATTGGGCCCCGGGCATGAGGAGG No data
926730203_926730223 28 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730223 2:16030753-16030775 TACCTAAGCGGGGGCGGTGTTGG No data
926730203_926730211 -1 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730211 2:16030724-16030746 AGGATTGGGCCCCGGGCATGAGG No data
926730203_926730214 4 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730203_926730226 30 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730226 2:16030755-16030777 CCTAAGCGGGGGCGGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730203 Original CRISPR TGCCCATAGGCTCACCCTCT GGG (reversed) Intergenic
No off target data available for this crispr