ID: 926730207

View in Genome Browser
Species Human (GRCh38)
Location 2:16030710-16030732
Sequence GTGAGCCTATGGGCAGGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730193_926730207 8 Left 926730193 2:16030679-16030701 CCAGCTGCCCTGCGGACCCACCA No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730199_926730207 -9 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730187_926730207 24 Left 926730187 2:16030663-16030685 CCTCCAGCCCAGTTTCCCAGCTG No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730198_926730207 -8 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730188_926730207 21 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730195_926730207 0 Left 926730195 2:16030687-16030709 CCTGCGGACCCACCACCCAGAGG No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730194_926730207 1 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730190_926730207 16 Left 926730190 2:16030671-16030693 CCAGTTTCCCAGCTGCCCTGCGG No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730189_926730207 17 Left 926730189 2:16030670-16030692 CCCAGTTTCCCAGCTGCCCTGCG No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730192_926730207 9 Left 926730192 2:16030678-16030700 CCCAGCTGCCCTGCGGACCCACC No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data
926730186_926730207 28 Left 926730186 2:16030659-16030681 CCTACCTCCAGCCCAGTTTCCCA No data
Right 926730207 2:16030710-16030732 GTGAGCCTATGGGCAGGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730207 Original CRISPR GTGAGCCTATGGGCAGGATT GGG Intergenic
No off target data available for this crispr