ID: 926730210

View in Genome Browser
Species Human (GRCh38)
Location 2:16030717-16030739
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730199_926730210 -2 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730192_926730210 16 Left 926730192 2:16030678-16030700 CCCAGCTGCCCTGCGGACCCACC No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730198_926730210 -1 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730190_926730210 23 Left 926730190 2:16030671-16030693 CCAGTTTCCCAGCTGCCCTGCGG No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730193_926730210 15 Left 926730193 2:16030679-16030701 CCAGCTGCCCTGCGGACCCACCA No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730203_926730210 -8 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730194_926730210 8 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730188_926730210 28 Left 926730188 2:16030666-16030688 CCAGCCCAGTTTCCCAGCTGCCC No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730200_926730210 -5 Left 926730200 2:16030699-16030721 CCACCCAGAGGGTGAGCCTATGG No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730189_926730210 24 Left 926730189 2:16030670-16030692 CCCAGTTTCCCAGCTGCCCTGCG No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730204_926730210 -9 Left 926730204 2:16030703-16030725 CCAGAGGGTGAGCCTATGGGCAG No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data
926730195_926730210 7 Left 926730195 2:16030687-16030709 CCTGCGGACCCACCACCCAGAGG No data
Right 926730210 2:16030717-16030739 TATGGGCAGGATTGGGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type