ID: 926730214

View in Genome Browser
Species Human (GRCh38)
Location 2:16030729-16030751
Sequence TGGGCCCCGGGCATGAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730198_926730214 11 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730199_926730214 10 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730203_926730214 4 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730200_926730214 7 Left 926730200 2:16030699-16030721 CCACCCAGAGGGTGAGCCTATGG No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730208_926730214 -9 Left 926730208 2:16030715-16030737 CCTATGGGCAGGATTGGGCCCCG No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730194_926730214 20 Left 926730194 2:16030686-16030708 CCCTGCGGACCCACCACCCAGAG No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730195_926730214 19 Left 926730195 2:16030687-16030709 CCTGCGGACCCACCACCCAGAGG No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730193_926730214 27 Left 926730193 2:16030679-16030701 CCAGCTGCCCTGCGGACCCACCA No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730192_926730214 28 Left 926730192 2:16030678-16030700 CCCAGCTGCCCTGCGGACCCACC No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data
926730204_926730214 3 Left 926730204 2:16030703-16030725 CCAGAGGGTGAGCCTATGGGCAG No data
Right 926730214 2:16030729-16030751 TGGGCCCCGGGCATGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730214 Original CRISPR TGGGCCCCGGGCATGAGGAG GGG Intergenic
No off target data available for this crispr