ID: 926730220

View in Genome Browser
Species Human (GRCh38)
Location 2:16030743-16030765
Sequence GAGGAGGGGTTACCTAAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730200_926730220 21 Left 926730200 2:16030699-16030721 CCACCCAGAGGGTGAGCCTATGG No data
Right 926730220 2:16030743-16030765 GAGGAGGGGTTACCTAAGCGGGG No data
926730198_926730220 25 Left 926730198 2:16030695-16030717 CCCACCACCCAGAGGGTGAGCCT No data
Right 926730220 2:16030743-16030765 GAGGAGGGGTTACCTAAGCGGGG No data
926730203_926730220 18 Left 926730203 2:16030702-16030724 CCCAGAGGGTGAGCCTATGGGCA No data
Right 926730220 2:16030743-16030765 GAGGAGGGGTTACCTAAGCGGGG No data
926730199_926730220 24 Left 926730199 2:16030696-16030718 CCACCACCCAGAGGGTGAGCCTA No data
Right 926730220 2:16030743-16030765 GAGGAGGGGTTACCTAAGCGGGG No data
926730208_926730220 5 Left 926730208 2:16030715-16030737 CCTATGGGCAGGATTGGGCCCCG No data
Right 926730220 2:16030743-16030765 GAGGAGGGGTTACCTAAGCGGGG No data
926730204_926730220 17 Left 926730204 2:16030703-16030725 CCAGAGGGTGAGCCTATGGGCAG No data
Right 926730220 2:16030743-16030765 GAGGAGGGGTTACCTAAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730220 Original CRISPR GAGGAGGGGTTACCTAAGCG GGG Intergenic
No off target data available for this crispr