ID: 926730768

View in Genome Browser
Species Human (GRCh38)
Location 2:16034064-16034086
Sequence TTACCAGGCCACTCACACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926730760_926730768 9 Left 926730760 2:16034032-16034054 CCGTCGGCTCCTCACTGTCCCTT No data
Right 926730768 2:16034064-16034086 TTACCAGGCCACTCACACAGAGG No data
926730766_926730768 -9 Left 926730766 2:16034050-16034072 CCCTTGTAGGGGAGTTACCAGGC No data
Right 926730768 2:16034064-16034086 TTACCAGGCCACTCACACAGAGG No data
926730764_926730768 0 Left 926730764 2:16034041-16034063 CCTCACTGTCCCTTGTAGGGGAG No data
Right 926730768 2:16034064-16034086 TTACCAGGCCACTCACACAGAGG No data
926730759_926730768 16 Left 926730759 2:16034025-16034047 CCTACAGCCGTCGGCTCCTCACT No data
Right 926730768 2:16034064-16034086 TTACCAGGCCACTCACACAGAGG No data
926730767_926730768 -10 Left 926730767 2:16034051-16034073 CCTTGTAGGGGAGTTACCAGGCC No data
Right 926730768 2:16034064-16034086 TTACCAGGCCACTCACACAGAGG No data
926730757_926730768 29 Left 926730757 2:16034012-16034034 CCAGGGAGCAGTGCCTACAGCCG No data
Right 926730768 2:16034064-16034086 TTACCAGGCCACTCACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926730768 Original CRISPR TTACCAGGCCACTCACACAG AGG Intergenic
No off target data available for this crispr