ID: 926731219

View in Genome Browser
Species Human (GRCh38)
Location 2:16037200-16037222
Sequence TCTAGGGAACCATCTTGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926731213_926731219 11 Left 926731213 2:16037166-16037188 CCTAAAGCATGATAATGATTAAG No data
Right 926731219 2:16037200-16037222 TCTAGGGAACCATCTTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926731219 Original CRISPR TCTAGGGAACCATCTTGCAT GGG Intergenic
No off target data available for this crispr