ID: 926731450

View in Genome Browser
Species Human (GRCh38)
Location 2:16038793-16038815
Sequence CCCGTTCCAGCTGTTTCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926731445_926731450 0 Left 926731445 2:16038770-16038792 CCACAGCCCATGGAGTTCAGTGA No data
Right 926731450 2:16038793-16038815 CCCGTTCCAGCTGTTTCTGGCGG No data
926731446_926731450 -6 Left 926731446 2:16038776-16038798 CCCATGGAGTTCAGTGACCCGTT No data
Right 926731450 2:16038793-16038815 CCCGTTCCAGCTGTTTCTGGCGG No data
926731442_926731450 9 Left 926731442 2:16038761-16038783 CCCCAAGTACCACAGCCCATGGA No data
Right 926731450 2:16038793-16038815 CCCGTTCCAGCTGTTTCTGGCGG No data
926731443_926731450 8 Left 926731443 2:16038762-16038784 CCCAAGTACCACAGCCCATGGAG No data
Right 926731450 2:16038793-16038815 CCCGTTCCAGCTGTTTCTGGCGG No data
926731447_926731450 -7 Left 926731447 2:16038777-16038799 CCATGGAGTTCAGTGACCCGTTC No data
Right 926731450 2:16038793-16038815 CCCGTTCCAGCTGTTTCTGGCGG No data
926731444_926731450 7 Left 926731444 2:16038763-16038785 CCAAGTACCACAGCCCATGGAGT No data
Right 926731450 2:16038793-16038815 CCCGTTCCAGCTGTTTCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926731450 Original CRISPR CCCGTTCCAGCTGTTTCTGG CGG Intergenic
No off target data available for this crispr