ID: 926731635

View in Genome Browser
Species Human (GRCh38)
Location 2:16039925-16039947
Sequence GGCGCCAGTGGTATTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926731635_926731641 25 Left 926731635 2:16039925-16039947 CCTGTCTCAATACCACTGGCGCC No data
Right 926731641 2:16039973-16039995 GTTTTGCTACTTCTCAGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926731635 Original CRISPR GGCGCCAGTGGTATTGAGAC AGG (reversed) Intergenic
No off target data available for this crispr