ID: 926743236

View in Genome Browser
Species Human (GRCh38)
Location 2:16129337-16129359
Sequence AAGAGACAAGACCATAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
926743236_926743238 -6 Left 926743236 2:16129337-16129359 CCACATCTATGGTCTTGTCTCTT No data
Right 926743238 2:16129354-16129376 TCTCTTCTCTGCCTTGGTTTAGG No data
926743236_926743240 14 Left 926743236 2:16129337-16129359 CCACATCTATGGTCTTGTCTCTT No data
Right 926743240 2:16129374-16129396 AGGACTTCATCAGTTGTCCCTGG No data
926743236_926743241 30 Left 926743236 2:16129337-16129359 CCACATCTATGGTCTTGTCTCTT No data
Right 926743241 2:16129390-16129412 TCCCTGGTGCCATTTAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
926743236 Original CRISPR AAGAGACAAGACCATAGATG TGG (reversed) Intergenic
No off target data available for this crispr